We narrowed to 13,030 results for: Hal
-
Plasmid#234384PurposeBacterial expression for structure determination. May not contain entire coding region of gene.DepositorInsertNsp2_VEEV
TagsLVPRGSSSGLNDIFEAQKIEWHE and MHHHHHHSSGRENLYFQGExpressionBacterialPromoterT7Available SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
VEEV_KP282671.1_NSP2_FL_NHisTEV_CThromAvi
Plasmid#234383PurposeBacterial expression for structure determination. May not contain entire coding region of gene.DepositorInsertNsp2_VEEV
TagsLVPRGSSSGLNDIFEAQKIEWHE and MHHHHHHSSGRENLYFQGExpressionBacterialPromoterT7Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
EP001: pLenti CMV Blast::eGFP-RC-I-1-H11
Plasmid#209301PurposeExpression plasmid for RC-I-1-H11 (de novo virus-like particle designed by David Baker lab) with N-terminal eGFPDepositorInsertRC-I-1-H11
UseLentiviralTagseGFPAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
L0I75_tUBQ10_GG5-GG6
Plasmid#219714PurposeLevel 0 tUBQ10 terminator, GG5 and GG6 BsaI sites for golden gate assembly.DepositorInsertGG5-tUBQ10-GG6
UseSynthetic BiologyMutationWT terminator with added golden gate linkersAvailable SinceJuly 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
L0I89-pMUTE_GG0-1
Plasmid#219708PurposeLevel 0 pMUTE promoter, GG0 and GG1 BsaI sites for golden gate assembly.DepositorInsertGG0-pMUTE-GG1
UseSynthetic BiologyMutationWT promoter with added golden gate linkersAvailable SinceJune 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
L0I74-_tUBQ10_GG4-GG6
Plasmid#219713PurposeLevel 0 tUBQ10 terminator, GG4 and GG6 BsaI sites for golden gate assembly.DepositorInsertGG4-tUBQ10-GG6
UseSynthetic BiologyMutationWT terminator with added golden gate linkersAvailable SinceJune 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
L0I87-SPCHPromoter_GG0-1
Plasmid#219707PurposeLevel 0 pSPCH promoter, GG0 and GG1 BsaI sites for golden gate assembly.DepositorInsertGG0-pSPCH-GG1
UseSynthetic BiologyMutationWT promoter with added golden gate linkersAvailable SinceJune 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
-
AtS/MAR10 insulator sequence (GB3459)
Plasmid#160639PurposepEGB3a2 AtS/MAR10DepositorInsertAtS/MAR10 insulator sequence
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceJan. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAM-35s-CBL9-YFPc-1
Plasmid#102400Purposesplit YFP. Plant expression of CBL9-YFPc-1DepositorAvailable SinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAM-35s-CBL8-YFPc-1
Plasmid#102399Purposesplit YFP. Plant expression of CBL8-YFPc-1DepositorAvailable SinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAM-35s-CBL5-YFPc-1
Plasmid#102397Purposesplit YFP. Plant expression of CBL5-YFPc-1DepositorAvailable SinceOct. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAM-35s-Slah3-YFPn-1
Plasmid#102385Purposesplit YFP. Plant expression of Slah3-YFPn-1DepositorAvailable SinceOct. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJDS74-GG-NNN
Plasmid#44715DepositorTypeEmpty backboneTags3X Flag and FOKI WTExpressionMammalianPromoterCMVAvailable SinceApril 26, 2013AvailabilityAcademic Institutions and Nonprofits only -
pJDS70-GG-SNI
Plasmid#44713DepositorTypeEmpty backboneTags3X Flag and FOKI WTExpressionMammalianPromoterCMVAvailable SinceApril 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pJDS71-GG-SHD
Plasmid#44714DepositorTypeEmpty backboneTags3X Flag and FOKI WTExpressionMammalianPromoterCMVAvailable SinceApril 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
mCerulean C1
Plasmid#27796DepositorInsertmCerulean C1
ExpressionMammalianAvailable SinceMay 23, 2011AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Zeo-BFP-P2A-ppViperin
Plasmid#217482PurposeExpression of Blue Fluorescent Protein - P2A - medium length protein kinase R from chinook salmonDepositorInsertBFP-P2A-otPKRML
ExpressionMammalianPromoterCMVAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
35S:YFPc-RabG3b-DN
Plasmid#102374Purposefluorescent tagging. Plant expression of YFPc-RabG3b-DNDepositorAvailable SinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
35S:YFPc-RabG3b-WT
Plasmid#102373Purposefluorescent tagging. Plant expression of YFPc-RabG3b-WTDepositorAvailable SinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGAL - FFL[SEL]
Plasmid#1102DepositorInsertfirefly luciferase
ExpressionYeastMutationn/aAvailable SinceJan. 6, 2005AvailabilityAcademic Institutions and Nonprofits only -
pAM-35s-Lyk5-YFPn-1
Plasmid#102389Purposesplit YFP. Plant expression of Lyk5-YFPn-1DepositorAvailable SinceOct. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
UBI10:RFP-RabG3B-WT
Plasmid#102369Purposefluorescent tagging. Plant expression of RFP-RabG3B-WTDepositorAvailable SinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
UBI10:RFP-RabG3B-DN
Plasmid#102370Purposefluorescent tagging. Plant expression of RFP-RabG3B-DNDepositorAvailable SinceOct. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
CIPK2-upGFP
Plasmid#117863Purposeprotein expressionDepositorAvailable SinceDec. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZZ006-AlcA::DM2h[Bla-1] G301A K302A-Myc
Plasmid#246383PurposeStable transformation or transient expression of gene if interests in plantsDepositorInsertDM2h[Bla-1] (AT3G44670 Mustard Weed)
ExpressionPlantMutationTGGGATTGGTAAGACAACTAT to TGGGATTGCTGCGACAACTAT am…Available SinceMay 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pZZ006-AlcA::DM2h[Bla-1] S111A H112A-Myc
Plasmid#246382PurposeStable transformation or transient expression of gene if interests in plantsDepositorInsertDM2h[Bla-1] (AT3G44670 Mustard Weed)
ExpressionPlantMutationCCATTCTTAGTCACATCCTCGAA to AAAACCATTCTTGCTGCTATCC…Available SinceMay 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
-
pICSL12002
Plasmid#245626PurposeLevel 0 Golden Gate part pAt6: Ubiquitin / AtUbl5 (At5g42300) promoter, GGAG - AATGDepositorInsertpAt6: Ubiquitin / AtUbl5 (At5g42300) promoter
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pICSL12030
Plasmid#245637PurposeLevel 0 Golden Gate part pAt1: Tip Delta (AT3g16240) promoter, GGAG - AATGDepositorInsertpAt1: Tip Delta (AT3g16240) promoter
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceJan. 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
pICSL12028
Plasmid#245635PurposeLevel 0 Golden Gate part pAt2: Rib Prot16 (At4g34620) promoter, GGAG - AATGDepositorInsertpAt2: Rib Prot16 (At4g34620) promoter
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICSL12029
Plasmid#245636PurposeLevel 0 Golden Gate part pAt5: XET (At5g65730) promoter, GGAG - AATGDepositorInsertpAt5: XET (At5g65730) promoter
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICSL12007
Plasmid#245628PurposeLevel 0 Golden Gate part pAt3: Cysteine Synthase (At3g61440) promoter, GGAG - AATGDepositorInsertpAt3: Cysteine Synthase (At3g61440) promoter
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICSL12001
Plasmid#245625PurposeLevel 0 Golden Gate part pAt4: AtPSBQ (At4g21280) promoter, GGAG - AATGDepositorInsertpAt4: AtPSBQ (At4g21280) promoter
UseSynthetic BiologyMutationBsaI/BpiI sites removed by point-mutationAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGGE-AtREF6ΔZnF
Plasmid#246815PurposeA GreenGate entry vector containing coding region of AtREF6 without zinc finger domainDepositorInsertAtREF6_ZnF
UseGreengate cloning entry vectorAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
ISA585: PM-42
Plasmid#241970Purpose42 kb phagemid.DepositorInsertPM-42
UseSynthetic Biology; PhagemidExpressionBacterialAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
L0I84 - GG0-pAHP6-GG1
Plasmid#219706PurposeLevel 0 pAHP6 promoter, GG0 and GG1 BsaI sites for golden gate assembly.DepositorInsertGG0-pAHP6-GG1
UseSynthetic BiologyMutationWT promoter with added golden gate linkersAvailable SinceJune 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pK7-g7g8-K8
Plasmid#218220PurposeAllows users to clone two Spacer sequences into an arrray of AtU6-promoter driven sgRNAsDepositorInsertAtU6 promoters and sgRNA scaffolds
UseCRISPRAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pK3-g3g4-K4
Plasmid#218218PurposeAllows users to clone two Spacer sequences into an arrray of AtU6-promoter driven sgRNAsDepositorInsertAtU6 promoters and sgRNA scaffolds
UseCRISPRAvailable SinceMay 2, 2024AvailabilityAcademic Institutions and Nonprofits only