We narrowed to 2,889 results for: SRS
-
Plasmid#204631PurposeColE1 ori, KanR, TetR, Tet promoter with a codon optimized csTTA gene bearing an N-terminal hexahistidine tag followed by a SUMO tag and a TEV protease cleavage site.DepositorInsertHis-SUMO-TEV-CsTTA
UseSynthetic BiologyTagsHis Tag; SUMO Tag; TEV Protease SiteExpressionBacterialPromoterPLtetO-1 promoterAvailable SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
P18-pZE-SUMO-BuTTA
Plasmid#204632PurposeColE1 ori, KanR, TetR, Tet promoter with a codon optimized buTTA gene bearing an N-terminal hexahistidine tag followed by a SUMO tag and a TEV protease cleavage site.DepositorInsertHis-SUMO-TEV-BuTTA
UseSynthetic BiologyTagsHis Tag; SUMO Tag; TEV Protease SiteExpressionBacterialPromoterPLtetO-1 promoterAvailable SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
P24-pZE-SUMO-KaTTA
Plasmid#204633PurposeColE1 ori, KanR, TetR, Tet promoter with a codon optimized kaTTA gene bearing an N-terminal hexahistidine tag followed by a SUMO tag and a TEV protease cleavage site.DepositorInsertHis-SUMO-TEV-KaTTA
UseSynthetic BiologyTagsHis Tag; SUMO Tag; TEV Protease SiteExpressionBacterialPromoterPLtetO-1 promoterAvailable SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV_PGK_3xHA-LTB4R(T308A)
Plasmid#208092PurposeMammalian expression of the human LTB4 receptor LTB4R with the T308A mutation with an N-terminal 3x HA tag.DepositorInsert3xHA-LTB4R(T308A) (LTB4R Human)
UseLentiviralTags3xHAExpressionMammalianMutationT308APromoterPGKAvailable SinceNov. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV_PGK_3xHA-LTB4R(S310A)
Plasmid#208093PurposeMammalian expression of the human LTB4 receptor LTB4R with the S310A mutation with an N-terminal 3x HA tag.DepositorInsert3xHA-LTB4R(S310A) (LTB4R Human)
UseLentiviralTags3xHAExpressionMammalianMutationS310APromoterPGKAvailable SinceNov. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV_PGK_3xHA-LTB4R
Plasmid#208091PurposeMammalian expression of the wild-type human LTB4 receptor LTB4R with an N-terminal 3x HA tag.DepositorInsert3xHA-LTB4R (LTB4R Human)
UseLentiviralTags3xHAExpressionMammalianMutationnonePromoterPGKAvailable SinceNov. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-DIO-hfCas13d-pA
Plasmid#195866PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNHT7
Plasmid#186753PurposeA basic cloning vector for inserting genes with 5' and 3' UTRs for later subcloning via Golden Gate assembly.DepositorTypeEmpty backboneUseSynthetic Biology; Cloning backbonePromoterT7Available SinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX458-Ef1a-Cas9-GFP (gRNA: DHS-4D-3)
Plasmid#159664PurposeCRISPR/Cas9 expressing plasmid containing the gRNA targeting an enhancer of mouse Otx2.DepositorInserthSpCas9
UseCRISPRPromoterEf1aAvailable SinceJune 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX458-Ef1a-Cas9-GFP (gRNA: DHS-4D-2)
Plasmid#159663PurposeCRISPR/Cas9 expressing plasmid containing the gRNA targeting an enhancer of mouse Otx2.DepositorInserthSpCas9
UseCRISPRPromoterEf1aAvailable SinceMarch 22, 2021AvailabilityAcademic Institutions and Nonprofits only