We narrowed to 16,148 results for: 034
-
Plasmid#146813PurposeMammalian Expression of HsDCP1a_131-582DepositorInsertHsDCP1a_131-582 (DCP1A Human)
UseTagsExpressionMammalianMutationone silent mutation T1716G compared to the sequen…PromoterAvailable SinceJan. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRSFDuetP-HsEDC3_192-508del231-263_GST-HsRCK_D
Plasmid#146109PurposeBacterial Expression of HsEDC3_192-508del231-263-HsRckDepositorAvailable SinceJan. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-B3GALT5
Plasmid#192719PurposeGateway entry vector encoding human B3GALT5DepositorAvailable SinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-V5-SBP-C1-HsMex3C_1-225_AD
Plasmid#148497PurposeMammalian Expression of HsMex3C_1-225DepositorInsertHsMex3C_1-225 (MEX3C Human)
UseTagsExpressionMammalianMutationone non silent mutation compared to variant 2 fro…PromoterAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-puro-hCASP8
Plasmid#185378PurposeFor mammalian expression of guide RNA: AAGCAATCTGTCCTTCCTGA that targets human CASP8 (Caspase 8)DepositorAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-puro-hARAF-1
Plasmid#185367PurposeFor mammalian expression of guide RNA: caccgTGGTCTACCGACTCATCAAG that targets human ARAFDepositorAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmSmaug-del584-762-V5His6_C
Plasmid#146006PurposeInsect Expression of DmSmaug-del584-762DepositorInsertDmSmaug-del584-762 (smg Fly)
UseTagsExpressionInsectMutation7 silent mutations and a deletion of the AA 961-9…PromoterAvailable SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmSmaug-del_584-762-V5His6_C
Plasmid#146015PurposeInsect Expression of DmSmaug-del584-762DepositorInsertDmSmaug-del584-762 (smg Fly)
UseTagsExpressionInsectMutation7 silent mutations and a deletion of the AA 961-9…PromoterAvailable SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV V5-Eva1b
Plasmid#175158PurposeLentiviral expression of V5-tagged mouse Eva1bDepositorAvailable SinceJan. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCHCHD3-donor
Plasmid#176347PurposeCRISPR donor plasmid to create GFP fusion proteinsDepositorAvailable SinceNov. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHDX-donor
Plasmid#176353PurposeCRISPR donor plasmid to create GFP fusion proteinsDepositorAvailable SinceNov. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDNAJC1-donor
Plasmid#176340PurposeCRISPR donor plasmid to create GFP fusion proteinsDepositorAvailable SinceNov. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFLAG GLTPD2
Plasmid#170745PurposeThe plasmids contain inserts (ORFs) for expressing various members of the GlycoLipid Transfer Protein (GLTP) superfamily.DepositorInsertGLTPD2 (GLTPD2 Human)
UseTagsFLAGExpressionMammalianMutationV49F, V152A and D209E- Please see depositor comme…PromoterAvailable SinceJuly 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-3NFLAG-mLIG3-179-936
Plasmid#159316PurposeMammalian cell expression of mouse LIG3-179-936DepositorAvailable SinceApril 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lentiviral human Citron shRNA 1 GFP
Plasmid#155286PurposeLentiviral expression of human CIT shRNA, GFP expression, based on Addgene 12247DepositorAvailable SinceAug. 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAG-Scarlet-Borcs7-Q87X
Plasmid#118751PurposeExpresses scarlet tagged Borcs7-Q87XDepositorInsertBorcs7-Q87X cDNA (2010012O05Rik Mouse)
UseTagsmScarletExpressionMammalianMutationQ87XPromoterCAGAvailable SinceNov. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHH0103 UTROPHIN WW domain
Plasmid#104275PurposeBacterial expression of WW domain from UTROPHINDepositorInsertUTROPHIN WW domain (UTRN Human)
UseTagsGSTExpressionBacterialMutationcodon optimized for expression in bacteriaPromotertacAvailable SinceAug. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHH0103 PDZK10 WW domain
Plasmid#104285PurposeBacterial expression of WW domain from PDZK10DepositorInsertPDZK10 WW domain (FRMPD4 Human)
UseTagsGSTExpressionBacterialMutationcodon optimized for expression in bacteriaPromotertacAvailable SinceAug. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHH0103 ARHGAP9 WW domain
Plasmid#104286PurposeBacterial expression of WW domain from ARHGAP9DepositorInsertARHGAP9 WW domain (ARHGAP9 Human)
UseTagsGSTExpressionBacterialMutationcodon optimized for expression in bacteriaPromotertacAvailable SinceAug. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHH0103 FNBP4 WW domain #1
Plasmid#104263PurposeBacterial expression of WW domain #1 from FNBP4DepositorInsertFNBP4 WW domain #1 (FNBP4 Human)
UseTagsGSTExpressionBacterialMutationcodon optimized for expression in bacteriaPromotertacAvailable SinceAug. 28, 2018AvailabilityAcademic Institutions and Nonprofits only