We narrowed to 352 results for: pCDH
-
Plasmid#244312Purpose5' AAVLINK plasmid for PCDH11X expressionDepositorAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only
-
LLPS-pCDH-DDX6-CT
Plasmid#240014PurposeExpresses human DDX6-CT fused to EGFP in mammalian cellsDepositorInsertDDX6-CT (303-483)
UseLentiviralTags6xHis and EGFPAvailable SinceJune 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLPS-pCDH-DDX6-NT
Plasmid#240015PurposeExpresses human DDX6-NT fused to EGFP in mammalian cellsDepositorInsertDDX6-NT (1-302)
UseLentiviralTags6xHis and EGFPAvailable SinceJune 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDH-3_Flag-TET1-S-WT
Plasmid#232942PurposeExpresses short isoform of TET1 in mammalian cells in its wild-type formDepositorInsertTET1-S-WT (TET1 Human)
UseLentiviralAvailable SinceMay 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDH-no-Flag-TET1-S-WT
Plasmid#232941PurposeExpresses short isoform of TET1 in mammalian cells in its wild-type formDepositorInsertTET1-S-WT (TET1 Human)
UseLentiviralAvailable SinceMarch 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDH-3_Flag-ATP5MF
Plasmid#232950PurposeExpresses ATP5MFDepositorInsertATP5MF (ATP5MF Human)
UseLentiviralAvailable SinceMarch 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDH-3_Flag-ATP5PB
Plasmid#232949PurposeExpresses ATP5PBDepositorInsertATP5PB (ATP5F1 Human)
UseLentiviralAvailable SinceMarch 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only