We narrowed to 247 results for: ABE8e
-
Plasmid#184374PurposeMammalian expression of SuperFi-Cas9 ABE7 base editorDepositorInsertnABE-SuperFi-Cas9
UseCRISPRTagsFLAG, SV40 NLS, and nucleoplasmin NLSExpressionMammalianMutationD10A, Y1010D, Y1013D, Y1016D, V1018D, R1019D, Q10…PromoterEF-1α core promoterAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAT15541_dCBE-SuperFi-Cas9
Plasmid#184371PurposeMammalian expression of nuclease inactive SuperFi-Cas9 CBE base editorDepositorInsertdCBE-SuperFi-Cas9
UseCRISPRTags3X FLAG, SV40 NLS, and UGIExpressionMammalianMutationD10A, H840A, Y1010D, Y1013D, Y1016D, V1018D, R101…PromoterEF-1α core promoterAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAT15543_dABE-SuperFi-Cas9
Plasmid#184373PurposeMammalian expression of nuclease inactive SuperFi-Cas9 ABE7 base editorDepositorInsertdABE-SuperFi-Cas9
UseCRISPRTagsFLAG, SV40 NLS, and nucleoplasmin NLSExpressionMammalianMutationD10A, H840A, Y1010D, Y1013D, Y1016D, V1018D, R101…PromoterEF-1α core promoterAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-t
Plasmid#195342PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed gRNA targeting EGFP A110VDepositorInsertsecTadA(8e)-SpCas9-NG
gRNA ctctacgcgggtcttgtagt
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-nt
Plasmid#195343PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed nonsense non-targeting gRNADepositorInsertsecTadA(8e)-SpCas9-NG
gRNA gtgcacgacgccgtatgcga
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pYPQ-ABE-Cas9n-Act3.0
Plasmid#178956PurposeIt consists of a Cas9 nickase (D10A) fused with an adenine deaminase (ABE8e) and MS2-SunTag-activators (ScFv-sfGFP-2xTAD), enabling simultaneous A to G conversion and gene activation.DepositorInsertABE8e-zCas9-T2A-MS2-SunTag-rbcS-E9t-ter-ZmUbi-scFv-sfGFP-2xTAD-GB1-NOS-ter
UseCRISPRExpressionPlantAvailable SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQ-ABE-SpRYn-Act3.0
Plasmid#178959PurposeIt consists of a SpRY nickase (D10A) fused with an adenine deaminase (ABE8e) and MS2-SunTag-activators (ScFv-sfGFP-2xTAD), enabling simultaneous A to G conversion and gene activation.DepositorInsertABE8e-SpRY-T2A-MS2-SunTag-rbcS-E9t-ter-ZmUbi-scFv-sfGFP-2xTAD-GB1-NOS-ter
UseCRISPRExpressionPlantAvailable SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLQ11438
Plasmid#183204PurposepHR-EF1a-ABE8e-hyperdLbCas12a-NLS-mCherry-P2A-Puro-WPREDepositorInserthyperdCas12 base editor
UseCRISPR and LentiviralAvailable SinceJune 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLQ11440
Plasmid#183203PurposepHR-TRE3G-ABE8e-hyperdLbCas12a-NLS-P2A-mCherry-EFS-Puro-WPREDepositorInserthyperdCas12 base editor
UseCRISPR and LentiviralAvailable SinceJune 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRDA_867
Plasmid#231109PurposeA>G base editorDepositorInsertABE8e-nCas9-SpG-HA
UseCRISPR and LentiviralMutationD10AAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRDA_479
Plasmid#179099PurposeBE Cas expressionDepositorInsertABE8e (SpG)
UseCRISPR and LentiviralAvailable SinceJan. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRDA_429
Plasmid#179098PurposeBE Cas expressionDepositorInsertABE8e (Cas9-NG)
UseCRISPR and LentiviralAvailable SinceJan. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRDA_426
Plasmid#179097PurposeBE Cas expressionDepositorInsertABE8e
UseCRISPR and LentiviralAvailable SinceJan. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
RUBY-ABE#2
Plasmid#232176PurposeT-DNA vector with ecTadA8e-zCas9D10A and corresponding sgRNA to correct RUBYm2 and recover a vivid red color visible to the naked eyes.DepositorInsert2x35s-ecTadA8e-SpCas9-D10A-AtU3-sgRNA-mis4-gRNA scaffold
UseCRISPRTags3xflag and NLSExpressionPlantAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
3'-com-gRNA GG backbone (MOBE1-4)
Plasmid#219947PurposeGolden gate backbone for mammalian expression of Sp-gRNA with 3'-comDepositorInsertgRNA-com-3'end (S. pyogenes Cas9)
UseCRISPRExpressionMammalianPromoterU6Available SinceJuly 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT31
Plasmid#223403PurposeT-DNA vector for SpCas9-D10A based A-to-G base editing for dicot plants; NGG PAM; SpCas9D10A-ABE was driven by AtUBQ10 and the sgRNA was driven by AtU3 promoter; Hygromycin for plants selection.DepositorInsertAtUBQ10-ecTadA8e-SpCas9-D10A-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT37
Plasmid#223409PurposeT-DNA vector for SpRY-D10A based A-to-G base editing for dicot plants; NA or NG PAM preference; SpRYD10A-ABE was driven by AtUBQ10 and the sgRNA was driven by AtU3; Hygromycin for plants selection.DepositorInsertAtUBQ10-ecTadA8e-SpRY-D10A-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT40
Plasmid#223412PurposeT-DNA vector for SpRY-D10A based A-to-G base editing for monocot plants; NA or NG PAM preference; SpRYD10A-ABE was driven by ZmUbi1 and the sgRNA was driven by OsU3; Hygromycin for plants selection.DepositorInsertZmUbi-ecTadA8e-SpRY-D10A-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT33
Plasmid#223405PurposeT-DNA vector for SpCas9-D10A based A-to-G base editing for dicot plants; NGG PAM; SpCas9D10A-ABE was driven by 2x35s and the sgRNA was driven by AtU3 promoter; Kanamycin for plants selection.DepositorInsert2x35s-ecTadA8e-SpCas9-D10A-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT34
Plasmid#223406PurposeT-DNA vector for SpCas9-D10A based A-to-G base editing for monocot plants; NGG PAM; SpCas9D10A-ABE was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; Hygromycin for plants selection.DepositorInsertZmUbi-ecTadA8e-SpCas9-D10A-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only