We narrowed to 5,803 results for: SUP
-
Plasmid#215540PurposeGateway entry vector with the YPet fluorescent proteinDepositorInsertYPet
UseGateway entry vectorPromoternoneAvailable SinceMay 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pENTR221-Illusia
Plasmid#215442PurposeGateway entry vector with Illusia FRET reporter for integrin phosphorylationDepositorInsertIllusia
UseGateway entry vectorPromoternoneAvailable SinceMay 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pPB.DEST-Illusia
Plasmid#215444PurposePiggybac expression vector with Illusia FRET reporter for integrin phosphorylationDepositorInsertIllusia
UseTransposon-based stable expressionExpressionMammalianPromoterCAGAvailable SinceMay 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
TLCV2 - sgAP2S1 #2
Plasmid#202757PurposeEncodes Doxycycline inducible Cas9 and sgRNA targeting AP2S1DepositorInsertgRNA targeting AP2S1
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
TLCV2 - sgAP2S1 #1
Plasmid#202756PurposeEncodes Doxycycline inducible Cas9 and sgRNA targeting AP2S1DepositorInsertgRNA targeting AP2S1
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-RELA-PGK-EGFP
Plasmid#228051PurposeHomologous donor template for RELA knockout expressing EGFPDepositorInsertEGFP
UseCRISPRExpressionMammalianPromoterPGKAvailable SinceNov. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-RELB-PGK-EGFP
Plasmid#228052PurposeHomologous donor template for RELB knockout expressing EGFPDepositorInsertEGFP
UseCRISPRExpressionMammalianPromoterPGKAvailable SinceNov. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-RELC-PGK-EGFP
Plasmid#228053PurposeHomologous donor template for RELC knockout expressing EGFPDepositorInsertEGFP
UseCRISPRExpressionMammalianPromoterPGKAvailable SinceNov. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-RELA-PGK-tdTomato
Plasmid#228054PurposeHomologous donor template for RELA knockout expressing tdTomatoDepositorInserttdTomato
UseCRISPRExpressionMammalianPromoterPGKAvailable SinceNov. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-RELC-PGK-tdTomato
Plasmid#228056PurposeHomologous donor template for RELC knockout expressing tdTomatoDepositorInserttdTomato
UseCRISPRExpressionMammalianPromoterPGKAvailable SinceNov. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SEC18-L1374
Plasmid#226275PurposePlasmid expressing the SEC18 allele from L-1374, under control of its native promoterDepositorInsertSEC18 (SEC18 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SEC18-S288C
Plasmid#226274PurposePlasmid expressing the SEC18 allele from S288C, under control of its native promoterDepositorInsertSEC18 (SEC18 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SEC18-NCYC110
Plasmid#226277PurposePlasmid expressing the SEC18 allele from NCYC110, under control of its native promoterDepositorInsertSEC18 (SEC18 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SEC18-UWOPS872421
Plasmid#226276PurposePlasmid expressing the SEC18 allele from UWOPS87-2421, under control of its native promoterDepositorInsertSEC18 (SEC18 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS313-SCT1-S288C
Plasmid#226266PurposePlasmid expressing the SCT1 allele from S288C, under control of its native promoterDepositorInsertSCT1 (SCT1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS313-SCT1-L1374
Plasmid#226267PurposePlasmid expressing the SCT1 allele from L-1374, under control of its native promoterDepositorInsertSCT1 (SCT1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-LUG1
Plasmid#226265PurposePlasmid expressing Cas9 and gRNA TCTTCAAGTTACTCCAAGAG which targets the LUG1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#226263PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS313-SCT1-NCYC110
Plasmid#226269PurposePlasmid expressing the SCT1 allele from NCYC110, under control of its native promoterDepositorInsertSCT1 (SCT1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS313-SCT1-UWOPS872421
Plasmid#226268PurposePlasmid expressing the SCT1 allele from UWOPS87-2421, under control of its native promoterDepositorInsertSCT1 (SCT1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only