We narrowed to 31,399 results for: ide
-
Plasmid#229510PurposeExpresses Arabidopsis thaliana chaperones: Raf1,Raf2,RbcX2,BSD2,RbcX1DepositorInsertsExpressionBacterialMutationN terminus chloroplast transit peptide truncationPromoterT7Available SinceJune 20, 2025AvailabilityAcademic Institutions and Nonprofits only
-
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSumo24P7vB4
Plasmid#113073PurposePlasmid for highly efficient expression of engineered IL24 with binding affinity to cognate receptorsDepositorInsertHuman IL-24 engineered by computational design and fused with N-terminal SUMO tag (IL24 Human, SUMO part (Brachypodium distachyon))
TagsSUMOExpressionBacterialMutationQ60R, K62E, K68E, K77R, M80L, S88D, A89V, Q93R, Q…PromoterT7Available SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSumo24P7
Plasmid#113072PurposePlasmid for highly efficient expression of engineered IL24 with mutated binding sitesDepositorInsertHuman IL-24 engineered by computational design and fused with N-terminal SUMO tag (IL24 Human, SUMO part (Brachypodium distachyon))
TagsSUMOExpressionBacterialMutationQ60R, K62E, K68E, K77R, M80L, S88D, A89V, Q93R, Q…PromoterT7Available SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHBT-KRAS174
Plasmid#248050PurposeTo express His6 tag-Avi tag-TEV cleavage site-KRAS (residues 1-174) in E. coli, under the T7 promoter.DepositorInsertKRAS (KRAS Human)
TagsHis6 tag-Avi tag-TEV cleavage siteExpressionBacterialMutationincludes aa 1-174 onlyPromoterT7Available SinceNov. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E2-ChR2-mCherry
Plasmid#135634PurposeAAV vector to drive the expression of ChR2-mCherry in PV cortical interneuronsunder the control of the E2 regulatory elementDepositorHas ServiceAAV PHP.eB, AAV1, and AAV9InsertChR2-mCherry
UseAAVMutationNoneAvailable SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E2-GFP-fGFP
Plasmid#135631PurposeAAV vector to drive the expression of fGFP in PV cortical interneuronsunder the control of the E2 regulatory elementDepositorHas ServiceAAV PHP.eB, AAV1, and AAV9InsertGFP-fGFP
UseAAVMutationNoneAvailable SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E2-GCaMP6f
Plasmid#135632PurposeAAV vector to drive the expression of GCaMP6f in PV cortical interneuronsunder the control of the E2 regulatory elementDepositorHas ServiceAAV PHP.eB, AAV1, and AAV9InsertGCaMP6f
UseAAVMutationNoneAvailable SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E2-dTom-nlsdTom
Plasmid#135630PurposeAAV vector to drive the expression of dTomato in PV cortical interneurons under the control of the E2 regulatory elementDepositorHas ServiceAAV PHP.eB, AAV1, and AAV9InsertdTom-nlsdTom
UseAAVMutationNoneAvailable SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-E29-ChR2GFP2x
Plasmid#153437PurposeAAV vector to drive the expression of dChr2-GFP-P2A-GFP in PV cortical interneuronsunder the control of the E29 regulatory elementDepositorInsertChr2-GFP-P2A-GFP
UseAAVAvailable SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E2-Gq-P2A-dTomato
Plasmid#135635PurposeAAV vector to drive the expression of Gq-DREADD-P2A-dTomato in PV cortical interneuronsunder the control of the E2 regulatory elementDepositorHas ServiceAAV PHP.eB, AAV1, and AAV9InsertGq-P2A-dTomato
UseAAVMutationNoneAvailable SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E6-dTom-nlsdTom
Plasmid#135641PurposeAAV vector to drive the expression of dTomato in VIP cortical interneurons under the control of the E6 regulatory elementDepositorHas ServiceAAV1InsertdTom-nlsdTom
UseAAVMutationNoneAvailable SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E2-C1V1-eYFP
Plasmid#135633PurposeAAV vector to drive the expression of C1V1-eYFP in PV cortical interneuronsunder the control of the E2 regulatory elementDepositorHas ServiceAAV PHP.eB, AAV1, AAV5, and AAV9InsertC1V1-eYFP
UseAAVMutationNoneAvailable SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E5-dTom-nlsdTom
Plasmid#135640PurposeAAV vector to drive the expression of dTomato in PV cortical interneuronsunder the control of the E5 regulatory elementDepositorInsertdTom-nlsdTom
UseAAVMutationNoneAvailable SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-E22-ChR2GFP2x
Plasmid#153436PurposeAAV vector to drive the expression of dChr2-GFP-P2A-GFP in PV cortical interneuronsunder the control of the E22 regulatory elementDepositorInsertChr2-GFP-P2A-GFP
UseAAVAvailable SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET28 His-MBP-TEV-BAP-Human BCKDK
Plasmid#232116PurposeFor bacterial expression of Human BCKDK (AA31–412, missing precursor peptide) with an N-terminal biotin acceptor peptide and a cleavable His-MBP purification tag.DepositorInsertBCKDK (BCKDK Human)
Tags6 x His, Biotin acceptor peptide (BAP), Maltose-B…ExpressionBacterialPromoterT7 PromoterAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-E14-ChR2GFP2x
Plasmid#153435PurposeAAV vector to drive the expression of dChr2-GFP-P2A-GFP in PV cortical interneuronsunder the control of the E14 regulatory elementDepositorInsertChr2-GFP-P2A-GFP
UseAAVAvailable SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-E11-ChR2GFP2x
Plasmid#153434PurposeAAV vector to drive the expression of dChr2-GFP-P2A-GFP in PV cortical interneuronsunder the control of the E11 regulatory elementDepositorInsertChr2-GFP-P2A-GFP
UseAAVAvailable SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E8-dTom-nlsdTom
Plasmid#135643PurposeAAV vector to drive the expression of dTomato in PV cortical interneuronsunder the control of the E8 regulatory elementDepositorInsertdTom-nlsdTom
UseAAVMutationNoneAvailable SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
tPA-TGFa-SPMn-SpyTag003
Plasmid#246649PurposeExpresses tPA-TGFa-SPMn-SpyTag003 in mammalian cells for calcium-induced NeissLock protein ligation to epidermal growth factor receptor (EGFR)DepositorInserttPA-TGFa-SPMn-SpyTag003
TagsSignal peptide and SpyTag003ExpressionMammalianMutationConstruct contains the tPA signal peptide, Kringl…PromoterCMV promoterAvailable SinceOct. 31, 2025AvailabilityAcademic Institutions and Nonprofits only