We narrowed to 27,182 results for: gfp
-
Plasmid#136005PurposeDOX-inducible G3BP1 with RNA binding domains deleted inserted with GFP tagged on the N-terminus and used with the Flp-In T-Rex SystemDepositorInsertG3BP1 (G3BP1 Human)
TagsEGFPExpressionMammalianMutationC-term of G3BP1 Deleted for Delta RBPAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHR-Gal4UAS-GFP-PGK-BFP
Plasmid#247506PurposeGAL4/UAS expression of GFP and constitutive expression of BFPDepositorInsertGAL4/UAS expression of GFP and constitutive expression of BFP
UseLentiviralExpressionMammalianAvailable SinceDec. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBMN-FKBP DD(L106P)-UbK0G75S-sfGFP
Plasmid#170157PurposeExpression for LIBRON constructsDepositorInsertFKBP DD (L106P)-UbK0G75S
UseRetroviralTagssfGFPMutationchange all lysin residues of ubiquitin to Arg, G7…Available SinceAug. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
TRE-UBC-hCD47-T2A-GFP
Plasmid#205458Purposelentiviral plasmid for expression of human CD47DepositorAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEF1a-donor_opt(R2Tg)-GFP(intron)
Plasmid#223252PurposeMammalian expression of the optimized R2Tg RNA donorDepositorInsertR2Tg donor_opt
ExpressionMammalianAvailable SinceAug. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
14UAS PSD95:GFP 5UAS DSRedExpress
Plasmid#74315PurposeEncodes a PSD95:GFP fusion protein and DsRedExpress from separate UAS cassettes; for long-term two-photon time-lapse imaging of dendrite growth and synaptogenesis in zebrafishDepositorInsertszebrafish PSD95
DsRedExpress
TagsEGFPMutationY599H and I793S (please see depositor comment bel…Available SinceMay 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSFV_eGFP-P2A-luc2pre (3'UTR)_RLEloop
Plasmid#240255PurposeAttenuated PROTEUS vector with eGFP-LUC transgene. Package VLVs with an envelope-expressing vector such as pCMV-VSV-G, or a transgene-responsive VSV-G expression vector.DepositorInsertEGFP-P2A-firefly luciferase
ExpressionMammalianPromoterSFV subgenomic promoterAvailable SinceFeb. 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
qTAG-AAVS1-PGK-Puro-moxGFP
Plasmid#227275PurposeAAVS1 targeting donor for the insertion of Puro and a medium strength PGK expressing moxGFP. To be co-transfected with sgRNA plasmid px330-AAVS1 (Addgene #227272)DepositorInsertAAVS1 Homology Arms flanking a 2A-Puro-PGK-moxGFP cassette (AAVS1 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-FLEX-rc[Chronos-GFP]
Plasmid#62722PurposeAAV-mediated expression of Chronos-GFP under the Syn promoter, in floxed/reversed (Cre-dependent) manner. Using bGHpA signal.DepositorInsertChronos-GFP
UseAAVTagsGFPExpressionMammalianPromoterhuman synapsin promoterAvailable SinceApril 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only