We narrowed to 7,700 results for: aav
-
Plasmid#202616PurposeGenetically encoded voltage indicator (GEVI) JEDI-1P in AAV production vector for astrocytes specific expression using the promoter GFAPDepositorInsertJEDI-1P
UseAAVExpressionMammalianPromoterGFAPAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-SYN-GFP-BGHpA
Plasmid#190229PurposeExpresses EGFP in neuronal cellsDepositorInsertEGFP
UseAAVExpressionMammalianAvailable SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAav-TP53-T2A-BirA*
Plasmid#115652PurposerAAV-based donor template for genome engineering of the TP53 protein C-terminus containing a T2A-BirA* module and a selection cassetteDepositorUseAAVTagsBirA* and T2AMutationHomology region 1 and Homology region 2Available SinceOct. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-CAG-mScarlet-I-Cdt1
Plasmid#191100PurposeTo express a bright monomeric red FP to label eucaryotic cell nuclei. To be used in tissue clearing methods and other fluorescent microscopy methodsDepositorInsertmScarlet-I-Cdt1 (30-120)
UseAAV and Synthetic BiologyTagsmScarlet-I fused to residues 30-120 of human Cdt1…ExpressionMammalianMutationOptimized to human codon usagePromoterCMV enhancer and CAGAvailable SinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-CsChR-GFP
Plasmid#58841PurposeAAV expression of CsChR-GFP under the Syn promoterDepositorInsertCsChR-GFP
UseAAVTagsGFPExpressionMammalianPromoterSynAvailable SinceAug. 14, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α1.1-Chronos-tdTomato
Plasmid#122099PurposeAAV-mediated expression of Chronos-tdTomato under the EF1α promoter (1.1kb short version). tdTomato has codons varied to reduce recombination. Using SV40 pA signal.DepositorInsertChronos-tdTomato
UseAAVTagstdTomatoExpressionMammalianPromoterEF1α (1.1 kb short version)Available SinceAug. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV.GFAP.(cyto).iATPSnFR2.A95K.HaloTag
Plasmid#209660PurposeExpression of iATPSnFR2, medium affinityDepositorInsertiATPSnFR2.A95K.HaloTag
UseAAVMutationA95KPromoterGFAPAvailable SinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-ChromeQ-GFP
Plasmid#123317PurposeAAV-mediated expression of ChromeQ-GFP under the Syn promoter.DepositorInsertChromeQ-GFP
UseAAVTagsGFPExpressionMammalianMutationChannelrhodopsin-2 (ChR2) with mutations A71S/ E9…PromoterSynAvailable SinceMarch 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG13C/sgKras/Cre
Plasmid#99856PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G13C mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV asyn S87A/S129A
Plasmid#36070DepositorInsertalpha-synuclein S87A/S129A (SNCA Human)
UseAAVExpressionMammalianMutationS87A/S129APromoterCMVAvailable SinceSept. 10, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-Neo-TNNT2-Puro
Plasmid#214016PurposeExpression of cardiac troponin TDepositorInsertTNNT2 (TNNT2 Human)
ExpressionMammalianAvailable SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-Neo-TNNT2-Zeo
Plasmid#214017PurposeExpression of cardiac troponin TDepositorInsertTNNT2 (TNNT2 Human)
ExpressionMammalianAvailable SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSyn.FLEX.FAPdL5-POST-T2A-dTomato.FLEX.WPRE.SV40
Plasmid#105982PurposeThis AAV plasmid in the presence of Cre recombinase expresses an extracellular dL5 FAP fused to the neuroligin-1 cytoplasmic domain for targeting to the synapse with a cell fill dTomato.DepositorInsertFLEX-FAPdL5-POST-T2A-dTomato.FLEX
UseAAV and Cre/LoxTagsFAPdL5-POST, T2A-dTomato, and mycExpressionMammalianPromoterhuman synapsin 1Available SinceOct. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR204-5p-TS
Plasmid#117380PurposeAn AAV genome containing miRNA target sequence (TS) 204-5p to reduce expression of the fluorescent protein eYFP in astrocytesDepositorInsertEYFP + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV-CAG-K-red-SPOTIT
Plasmid#191490PurposeRed fluorescent-based opioid sensor for the kappa opioid receptor in AAV viral vector under a CAG promoterDepositorInsertK-red-SPOTIT
UseAAVPromoterCAGAvailable SinceApril 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-GRAB_CCK1.0
Plasmid#208674PurposeExpresses the genetically-encoded fluorescent cholecystokinin (CCK) sensor GRAB_CCK1.0 in a cre-dependent mannerDepositorInsertGPCR activation based cholecystokinin (CCK) sensor GRAB_CCK1.0
UseAAVPromoterhSynAvailable SinceOct. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAav-MCS-PQS2-3xHA
Plasmid#84917PurposerAAV-based template for genome engineering of protein C-termini containing PQS2 and 3xHA tags and a selection cassetteDepositorInsertLOX-PGK-NEO-LOX
UseAAVTagsPQS2 3xHAPromotermPGKAvailable SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SEO-CaMKII-EGFP
Plasmid#177018PurposeFor expression of EGFP in a single-floxed, excisable open reading frame (cre-off), under control of the CaMKIIa promoterDepositorInsertEGFP
UseAAV, Cre/Lox, and Mouse TargetingExpressionMammalianPromoterCaMKIIaAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Tbg-CES2A-ΔC-S227A
Plasmid#200560PurposeSecreted mouse CES2A S227A mutant driven by heptaocyte-specific promoter in AAV viral vectorDepositorInsertMouse Carboxylesterase 2A S227A mutant delta C-terminal (Ces2a Mouse)
UseAAVTagsFlagPromoterCMV promoterAvailable SinceMay 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOttc1495 - pAAV CaMKII SERCaMP_ASARTDL
Plasmid#192602PurposeAn AAV packaging vector that expresses SERCaMP under control of the CaMKII promoter.DepositorInsertSERCaMP
UseAAVPromoterCaMKIIAvailable SinceJan. 6, 2023AvailabilityAcademic Institutions and Nonprofits only