We narrowed to 15,623 results for: grna
-
Plasmid#135747PurposeEncodes gRNA for 3' target of human ZBTB7BDepositorAvailable SinceJan. 28, 2020AvailabilityAcademic Institutions and Nonprofits only
-
PX330_ZBTB7B_1
Plasmid#135746PurposeEncodes gRNA for 3' target of human ZBTB7BDepositorAvailable SinceJan. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBK546
Plasmid#239839PurposepLV-U6-[hSNCA gRNA 4]-EFSNC-dSpCas9-DNMT3a-P2A-PURO-WPREDepositorInsertpLV-U6-[hSNCA gRNA 4]-EFSNC-dSpCas9-DNMT3a-P2A-PURO-WPRE
UseLentiviralPromoterCMVAvailable SinceNov. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-hASCL1 gRNA_1-MS2-Puro
Plasmid#192670PurposeLentiviral expression of sgRNA targeting hASCL1 promoter to activate human ASCL1 transcriptionDepositorInsertHuman ASCL1 activating gRNA #1 (ASCL1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-mHbb-bh1_ gRNA_1-MS2-Puro
Plasmid#192681PurposeLentiviral expression of sgRNA targeting mHbb-bh1promoter to activate mouse Hbb-bh1 transcriptionDepositorInsertMouse Hbb-bh1 activating gRNA #1 (Hbb-bh1 Mouse)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNT/Cre
Plasmid#66895PurposeExpresses a non-targeting gRNA and Cre-recombinaseDepositorInsertsgNT
UseCRISPR, Cre/Lox, Lentiviral, and Mouse TargetingExpressionMammalianPromoterU6Available SinceAug. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 2-exon 8
Plasmid#163321PurposeSpCas9 ILK gRNA 2 (G*ACATTGTAGAGGGATCCATA), targeting exon 8 within the C-terminal protein kinase domain.DepositorInsertILK gRNA 2_Exon8
UseCRISPRExpressionMammalianPromoterU6FAvailable SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
KB601: pMAGIC (L5-L4) hU6::SaCas9 gRNA scaffold; EF1a promoter
Plasmid#121819PurposepMAGIC L5-L4 entry plasmid, contains empty human U6-driven SaCas9 gRNA scaffold and EF1a promoter for 4-component MultiSite Gateway Pro assembly. Protospacer motif can be inserted after BsaI digestionDepositorTypeEmpty backboneUseGateway Cloning and Synthetic BiologyAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX330-U6-MYC-Guide-hSpCas9
Plasmid#228574PurposeExpression of human MYC gRNA; CRISPR mediated gene insertionDepositorAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFH51
Plasmid#128213Purposeimproved sgRNA backbone for tRNA-gRNA array, Position 1, combine with OsU3 promoter module (pFH38)DepositorInsertimproved sgRNA backbone for tRNA-gRNA array, Position 1, combine with OsU3 promoter module (pFH38)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFH71
Plasmid#128214Purposeimproved sgRNA backbone for tRNA-gRNA array, Position 1, combine with TaU6 promoter module (pICSL90003)DepositorInsertimproved sgRNA backbone for tRNA-gRNA array, Position 1, combine with TaU6 promoter module (pICSL90003)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFH75
Plasmid#128224Purposeclassic sgRNA backbone for tRNA-gRNA array, Position 1, combine with TaU6 promoter module (pICSL90003)DepositorInsertclassic sgRNA backbone for tRNA-gRNA array, Position 1, combine with TaU6 promoter module (pICSL90003)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
C-term AAV-eVRQR-ACTA2-gRNA-A4 (mouse) (LLH310)
Plasmid#242662PurposeCBh promoter expression plasmid for C-terminal intein-split AAV construct with C-term of SpCas9-VRQR and mouse gRNA-A4DepositorInsertpAAV-pCbh-BPNLS-NpuC-SpCas9-VRQR-BPNLS-WPRE-bGH_PA-ACTA2_mouse_NGA_gRNA-pU6
UseAAV and CRISPRTagsBPNLSMutationVRQR mutations in SpCas9(S55R/D1135V/G1218R/R1335…PromoterCBhAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
C-term AAV-eVRQR-ACTA2-gRNA-A4 (human) (LLH301)
Plasmid#242661PurposeCBh promoter expression plasmid for C-terminal intein-split AAV construct with C-term of SpCas9-VRQR and human gRNA-A4DepositorInsertpAAV-pCbh-BPNLS-NpuC-SpCas9-VRQR-BPNLS-WPRE-bGH_PA-ACTA2_human_NGA_gRNA-pU6
UseAAV and CRISPRTagsBPNLSMutationVRQR mutations in SpCas9(S55R/D1135V/G1218R/R1335…PromoterCBhAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNcor1#1/Cre
Plasmid#173605PurposeExpresses a Ncor1-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Ncor1 (Ncor1 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgStag2#1/Cre
Plasmid#173659PurposeExpresses a Stag2-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Stag2 (Stag2 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceMay 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgStag2#2/Cre
Plasmid#173660PurposeExpresses a Stag2-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Stag2 (Stag2 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceMay 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv1.linker_KO
Plasmid#164688PurposeFor CRISPR knockout of miR-144~451 linker region by lentiviral delivery of Cas9 and linker gRNADepositorInsertmiR-144~451 linker CRISPR KO gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
STAGR_gRNAScaffold_mU6
Plasmid#102844PurposeCan be used as PCR template for a STAgR reactionDepositorInsertSTAgR Insert gRNAScaffold_mU6
UsePcr template for stagr insertsPromotermU6Available SinceFeb. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
p2T-U6-sgCTG
Plasmid#232723PurposeSpCas9 guide RNA targeting CAG repeats for C-to-T base editingDepositorInsertSpCas9 gRNA targeting CAG repeats
ExpressionMammalianAvailable SinceMarch 3, 2025AvailabilityAcademic Institutions and Nonprofits only