We narrowed to 15,359 results for: GRN;
-
Plasmid#236203Purposelentiviral expression of Cas9 and encodes CT6 sgRNA for CLEC12A deletionDepositorInsertClec12a (Clec12a Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
sgRNA Clec12a (CT44)
Plasmid#236204Purposelentiviral expression of Cas9 and encodes CT44 sgRNA for CLEC12A deletionDepositorInsertClec12a (Clec12a Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
sgRNA Clec12a (CT47)
Plasmid#236205Purposelentiviral expression of Cas9 and encodes CT47 sgRNA for CLEC12A deletionDepositorInsertClec12a (Clec12a Mouse)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458_mCherry-SRRM2-gRNA
Plasmid#238251PurposeCas9 from S. pyogenes with 2A-mCherry, gRNA to knock-in msfGFP to SRRM2 locusDepositorInsertSRRM2
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458_mCherry-HP1a-gRNA-2
Plasmid#237635PurposeCas9 from S. pyogenes with 2A-mCherry, gRNA to knock-in msfGFP to HP1a locusDepositorInsertHP1a gRNA (CBX5 Human)
UseCRISPRTagsmCherryExpressionMutationPromoterAvailable sinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458_mCherry-HP1a-gRNA-1
Plasmid#237634PurposeCas9 from S. pyogenes with 2A-mCherry, gRNA to knock-in msfGFP to HP1a locusDepositorInsertHP1a gRNA (CBX5 Human)
UseCRISPRTagsmCherryExpressionMutationPromoterAvailable sinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458_mCherry-EWSR1-gRNA
Plasmid#237683PurposeCas9 from S. pyogenes with 2A-mCherry, gRNA to knock-in msfGFP to EWSR1 locusDepositorInsertEWSR1 gRNA (EWSR1 Human)
UseCRISPRTagsmCherryExpressionMutationPromoterAvailable sinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458_mCherry-TCOF1-gRNA
Plasmid#237633PurposeCas9 from S. pyogenes with 2A-mCherry, gRNA to knock-in msfGFP to TCOF1 locusDepositorInsertTCOF1 gRNA (TCOF1 Human)
UseCRISPRTagsmCherryExpressionMutationPromoterAvailable sinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458_mCherry-FUS-gRNA
Plasmid#237685PurposeCas9 from S. pyogenes with 2A-mCherry, gRNA to knock-in msfGFP to FUS locusDepositorInsertFUS gRNA (FUS Human)
UseCRISPRTagsmCherryExpressionMutationPromoterAvailable sinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-NT-1mer-gRNA
Plasmid#227500Purposenon-targeting control guideDepositorInsertNon-targeting gRNA
UseCRISPRTagsExpressionMutationPromoterAvailable sinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
RNF168 C-terminal sgRNA
Plasmid#207100PurposepX330 based plasmid for expression of Cas9 and the GAGATGCACAAAGTAAGGCC sgRNA to target the RNF168 locus.DepositorInsertGAGATGCACAAAGTAAGGCC
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
RIF C-terminal sgRNA
Plasmid#207096PurposepX330 based plasmid for expression of Cas9 and the AATACTAAATAGAATTTTCA sgRNA to target the RIF1 locus.DepositorInsertAATACTAAATAGAATTTTCA
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
Halo XLF sgRNA
Plasmid#207605PurposesgRNA for the insert of the HaloTag at the endogenous loci of XLFDepositorInsertGTTCTTCCATctgcaaaaaa
UseTagsNoneExpressionMammalianMutationPromoterAvailable sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
hNTa2-qgRNA-pYJA5
Plasmid#217780PurposeNon-targeting control 2 qgRNA-pYJA5 plasmid from the T.gonfio library; it can be used as a ready-to-go control and provides the three constant regions for the three-fragment PCRs for qgRNA cloningDepositorInsertQuadruple sgRNA-expression cassette for nontargeting control for gene activation and epigenetic silencing
UseCRISPR, Lentiviral, and Synthetic BiologyTagsExpressionMammalianMutationPromoterhuman U6, mouse U6, human H1, human 7SKAvailable sinceApril 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX458-eBFP2-sgRNA_CTCF_ZF1
Plasmid#233090PurposeExpression vector for a sgRNA against the mouse CTCF ZF1 region and SpCas9-T2A-eBFP2.DepositorInsertspCas9-T2A-eBFP2 (Ctcf )
UseTagsExpressionMammalianMutationPromoterAvailable sinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
NOLC1 atgRNA pDY2250
Plasmid#219860Purposeattachment site pegRNA for human NOLC1DepositorInsertNOLC1 atgRNA (NOLC1 Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pABE-dGFP-gRNA
Plasmid#226864PurposeHuman gRNA expression vector targeting the A111V mutation of non-fluorescent EGFP in plasmid pABE-dGFP; for use with ABEsDepositorInsertSp-gRNA
UseTagsExpressionMammalianMutationPromoterhU6Available sinceFeb. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCBE-dGFP-gRNA
Plasmid#226862PurposeHuman gRNA expression vector targeting the Y93H mutation of non-fluorescent EGFP in plasmid pCBE-dGFP; for use with CBEsDepositorInsertSp-gRNA
UseTagsExpressionMammalianMutationPromoterhU6Available sinceFeb. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
gRNA giantin/GOLGB1
Plasmid#222315PurposeCRISPR/Cas9 close to the ATG of giantin/GOLGB1 gene.DepositorInsertgRNA targeting GOLB1 (GOLGB1 Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceFeb. 4, 2025AvailabilityAcademic Institutions and Nonprofits only