We narrowed to 171,128 results for: addgene
-
Plasmid#228950Purposeexpress the full-length human SAE1:SAE2 heterodimer ( where SAE1 is untagged and SAE2 contains an N-terminal tag : MGSSHHHHHHSQDADLNSRVD, derivated from the Addgene plasmid #52258 pSUMO1)DepositorTagsHis tag and thrombine cleavage site : MGSSHHHHHHS…ExpressionBacterialPromoterRBS and T7-lacAvailable SinceMay 16, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pX458-ITGB6
Plasmid#235244PurposeEncodes gRNA for human ITGB6DepositorAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
Vsx2 hR0-36 +SV40 base prom-GFP-IRES-AP
Plasmid#225881PurposeEnhancer reporterDepositorInserthR0-36
TagsEGFPExpressionMammalianAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
Vsx2 hR1-25 +SV40 base prom-GFP-IRES-AP
Plasmid#225882PurposeEnhancer reporterDepositorInserthR1-25
TagsEGFPExpressionMammalianAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
Vsx2 hR2-20 +SV40 base prom-GFP-IRES-AP
Plasmid#225883PurposeEnhancer reporterDepositorInserthR2-20
TagsEGFPExpressionMammalianAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
Vsx2 hR3-16 +SV40 base prom-GFP-IRES-AP
Plasmid#225884PurposeEnhancer reporterDepositorInserthR3-16
TagsEGFPExpressionMammalianAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
Vsx2 mR0-37 +SV40 base prom-GFP-IRES-AP
Plasmid#225885PurposeEnhancer reporterDepositorInsertmR0-37
TagsEGFPExpressionMammalianAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
Vsx2 mR1-28 +SV40 base prom-GFP-IRES-AP
Plasmid#225886PurposeEnhancer reporterDepositorInsertmR1-28
TagsEGFPExpressionMammalianAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
Vsx2 mR2-22 +SV40 base prom-GFP-IRES-AP
Plasmid#225887PurposeEnhancer reporterDepositorInsertmR2-22
TagsEGFPExpressionMammalianAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
Vsx2 mR3-17 +SV40 base prom-GFP-IRES-AP
Plasmid#225888PurposeEnhancer reporterDepositorInsertmR3-17
TagsEGFPExpressionMammalianAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
Vsx2 mR0-37a +SV40 base prom-GFP-IRES-AP
Plasmid#225889PurposeEnhancer reporterDepositorInsertmR0-37a
TagsEGFPExpressionMammalianAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
Vsx2 mR3-17c +SV40 base prom-GFP-IRES-AP
Plasmid#225890PurposeEnhancer reporterDepositorInsertmR3-17c
TagsEGFPExpressionMammalianAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
Vsx2 mR3-17d +SV40 base prom-GFP-IRES-AP
Plasmid#225891PurposeEnhancer reporterDepositorInsertmR3-17d
TagsEGFPExpressionMammalianAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
PGK-GFP-LAMP1TM
Plasmid#234874PurposeLentiviral plasmid expressing GFP fused to the transmembrane domain and cytosolic tail of LAMP-1. Designed as a control vector for PGK-HA-PGRN-LAMP1TM.DepositorInsertEGFP
UseLentiviralTagsLAMP-1 transmembrane domain and cytosolic tailExpressionMammalianPromoterPGKAvailable SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 SATtoG KtoR
Plasmid#232961PurposeGalactose iduced expression of Gcn4 ATtoG KtoR in yeastDepositorInsertGcn4 SATtoG KtoR
TagsTEV cleavage siteExpressionYeastMutationS101G, T102G, S104G, T105G, S117G, K118R, T121G, …PromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 solvvol
Plasmid#232976PurposeGalactose iduced expression of Gcn4 solvvol in yeastDepositorInsertGcn4 solvvol
TagsTEV cleavage siteExpressionYeastMutationS101T, D103E, S104T, D115E, N116Q, S117T, S122T, …PromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 ILVtoED WHA
Plasmid#232995PurposeGalactose iduced expression of Gcn4 ILVtoED W+HAin yeastDepositorInsertGcn4 ILVtoED W+
Tags3xHA and TEV cleavage siteExpressionYeastMutationN126W, I128E, V130E, V135E, L137D, I142DPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 9acidAGFP
Plasmid#233009PurposeGalactose iduced expression of Gcn4 9acidAGFP in yeastDepositorInsertGcn4 9acidA
TagsHA-GFP-HA and TEV cleavage siteExpressionYeastMutationE109A, E111A, E114A, D115A, E119A, D125A, D127A, …PromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 ILVtoED WGFP
Plasmid#233007PurposeGalactose iduced expression of Gcn4 LVtoED W+GFPin yeastDepositorInsertGcn4 ILVtoED W+
TagsHA-GFP-HA and TEV cleavage siteExpressionYeastMutationN126W, I128E, V130E, V135E, L137D, I142DPromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 solvvol W
Plasmid#232977PurposeGalactose iduced expression of Gcn4 solvvol W+ in yeastDepositorInsertGcn4 solvvol W+
Tags3xHA and TEV cleavage siteExpressionYeastMutationS101T, D103E, S104T, D115E, N116Q, S117T, S122T, …PromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1nh
Plasmid#160299PurposeYeast CRISPR plasmid targeting the natMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kn
Plasmid#160298PurposeYeast CRISPR plasmid targeting the kanMX and natMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHW1387
Plasmid#229880PurposeNegative selection marker for extrachromosomal arrays during RMCE crosses - Pmyo-2::HisCl1 cDNA::SL2::GFP-C1::tbb-2 3'UTRDepositorInsertPmyo-2::HisCl1 cDNA::SL2::GFP-C1::tbb-2 3'UTR
TagsGFP-C1ExpressionWormAvailable SinceFeb. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHW1392
Plasmid#229878PurposeNegative selection marker for extrachromosomal arrays during RMCE crosses- Psnt-1::HisCl1 cDNA::SL2::GFP-C1::tbb-2 3'UTRDepositorInsertPsnt-1::HisCl1 cDNA::SL2::GFP-C1::tbb-2 3'UTR
TagsGFP-C1ExpressionWormAvailable SinceFeb. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-LNPK-WPRE-UbC-Emerald
Plasmid#225953PurposeLentiviral vector plasmid expressing human lunapark (LNPK) under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-LNPK-WPRE-UbC-mCherry
Plasmid#225954PurposeLentiviral vector plasmid expressing human lunapark (LNPK) under the spleen focus-forming virus (SFFV) promoter and mCherry under the Ubiquitin C (UbC) promoterDepositorAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAGK58
Plasmid#228118PurposeExpress node 814 retron with split retron ncRNA and gRNA to edit (10bp barcode) EMX1 gene in human cellsDepositorInsertRetron node 814, split retron ncRNA and gRNA to edit EMX1 gene (10bp barcode) in human cells
ExpressionMammalianPromoterCAG for RT, U6/H1 for ncRNA/gRNAAvailable SinceJan. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
Tensin-2 Y483E
Plasmid#201794PurposeExpresses Tensin-2 protein with Y483E mutation in MAC-Tag-C backboneDepositorInsertTensin-2 (Tns2 Mouse)
TagsBirA, HA, strepIIIExpressionBacterial and MammalianMutationmutation Y483EAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tensin-2 Y483F
Plasmid#201795PurposeExpresses Tensin-2 protein with Y483F mutation in MAC-Tag-C backboneDepositorInsertTensin-2 (Tns2 Mouse)
TagsBirA, HA, strepIIIExpressionBacterial and MammalianMutationmutation Y483FAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tensin-2 Y483A
Plasmid#201796PurposeExpresses Tensin-2 protein with Y483A mutation in MAC-Tag-C backboneDepositorInsertTensin-2 (Tns2 Mouse)
TagsBirA, HA, strepIIIExpressionBacterial and MammalianMutationmutation Y483AAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCJ1023
Plasmid#228763PurposePlasmid expressing Cas9 and gRNAs for mouse Ift88 and Pkd2. Use for disruption of mouse Ift88 and Pkd2 in cultured cells.DepositorUseCRISPRTags3XFLAG and GFPExpressionMammalianPromoterhuman U6Available SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAGK65
Plasmid#228123PurposeExpress node 1795 retron with split retron ncRNA and gRNA to edit (10bp barcode) EMX1 gene in human cellsDepositorInsertRetron node 1550, split retron ncRNA and gRNA to edit EMX1 gene (10bp barcode) in human cells
ExpressionMammalianPromoterCAG for RT, U6/H1 for ncRNA/gRNAAvailable SinceDec. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAGK59
Plasmid#228119PurposeExpress node 1429 retron with split retron ncRNA and gRNA to edit (10bp barcode) EMX1 gene in human cellsDepositorInsertRetron node 1429, split retron ncRNA and gRNA to edit EMX1 gene (10bp barcode) in human cells
ExpressionMammalianPromoterCAG for RT, U6/H1 for ncRNA/gRNAAvailable SinceDec. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAGK57
Plasmid#228117PurposeExpress node 482 retron with split retron ncRNA and gRNA to edit (10bp barcode) EMX1 gene in human cellsDepositorInsertRetron node 482, split retron ncRNA and gRNA to edit EMX1 gene (10bp barcode) in human cells
ExpressionMammalianPromoterCAG for RT, U6/H1 for ncRNA/gRNAAvailable SinceDec. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAGK56
Plasmid#228116PurposeExpress node 412 retron with split retron ncRNA and gRNA to edit (10bp barcode) EMX1 gene in human cellsDepositorInsertRetron node 412, split retron ncRNA and gRNA to edit EMX1 gene (10bp barcode) in human cells
ExpressionMammalianPromoterCAG for RT, U6/H1 for ncRNA/gRNAAvailable SinceDec. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAGK60
Plasmid#228120PurposeExpress node 1438 retron with split retron ncRNA and gRNA to edit (10bp barcode) EMX1 gene in human cellsDepositorInsertRetron node 1438, split retron ncRNA and gRNA to edit EMX1 gene (10bp barcode) in human cells
ExpressionMammalianPromoterCAG for RT, U6/H1 for ncRNA/gRNAAvailable SinceDec. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAGK55
Plasmid#228114PurposeExpress node 2 retron with split retron ncRNA and gRNA to edit (10bp barcode) EMX1 gene in human cellsDepositorInsertRetron node 2, split retron ncRNA and gRNA to edit EMX1 gene (10bp barcode) in human cells
ExpressionMammalianPromoterCAG for RT, U6/H1 for ncRNA/gRNAAvailable SinceDec. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLIX401 APE1 CI
Plasmid#227191PurposeInducible lentiviral expression of CI (Catalytically Inactive) APE1DepositorInsertapurinic/apyrimidinic endonuclease APE1 (APEX1 Human)
UseLentiviralExpressionBacterial and MammalianMutationH309NAvailable SinceNov. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLVUT-spC3GFP
Plasmid#225487PurposeTet-on lentiviral vector for controlled expression of a secretable and permeable form of C. botulinum exoenzyme C3 transferase fused with EGFPDepositorInsertSecretable and permeable exoenzyme C3 transferase
UseLentiviralTagsEGFPExpressionMammalianMutationAmino acids 30-251PromoterHuman ubiquitin CAvailable SinceSept. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCL452
Plasmid#219502PurposeGolden Gate entry vector for library cloning of msd-sgRNA arrays: GAL7p-Csy4-PaqCI-PaqCI-GAL7t // SNR52p-msr-SUP4tDepositorInsertGAL7p-Csy4-PaqCI-PaqCI-GAL7t // SNR52p-msr-SUP4t
ExpressionYeastPromoterGAL7Available SinceMay 31, 2024AvailabilityAcademic Institutions and Nonprofits only