We narrowed to 4,390 results for: gca
-
Plasmid#201622PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertSNRPA (SNRPA Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
tet pLKO.1-shCLTC v1 puro
Plasmid#192347PurposeLentiviral expression vector for an inducible shCLTC v1DepositorInsertshCLTC v1 (CLTC Human)
UseLentiviralAvailable SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-guide-puro mNudcd3 - 2
Plasmid#198502Purposelentiviral stable expression of mNudcd3 gRNA 2DepositorAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-Teton-puro-shPP1C #1
Plasmid#198762Purposeconditional knockdown of PP1CDepositorInsertshPP1C #1 (PPP1CC Human)
ExpressionMammalianAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET-20b_HtrA2(delta(133))_S306A_6His
Plasmid#197975PurposeE. coli expression of HtrA2(delta133)-6HisDepositorAvailable SinceApril 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003 sgGPAA1 guide 1
Plasmid#193608PurposeGPAA1 knockoutDepositorInsertsgGPAA1 guide 1 (GPAA1 Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003 sgAP2M1 guide 1
Plasmid#193600PurposeAP2M1 knockoutDepositorInsertsgAP2M1 guide 1 (AP2M1 Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003 sgAP2M1 guide 2
Plasmid#193601PurposeAP2M1 knockoutDepositorInsertsgAP2M1 guide 2 (AP2M1 Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003 sgFADD guide 2
Plasmid#193590PurposeFADD knockoutDepositorInsertsgFADD guide 2 (FADD Human)
UseLentiviralAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Sa-gRNA-puro
Plasmid#191652PurposeLentiviral expression of puromycin resistance gene and S. aureus scrambled non-targeting gRNA ; useful for changing gRNA by mutagenesis.DepositorInsertS. aureus gRNAscr
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.179
Plasmid#185000PurposeExpress -Eco1 HEK4 editing ncRNA and gRNADepositorInsertEco1: HEK4 targeting and editing ncRNA-gRNA (a1/a2 length: 27 v1), expressed constitutively from a pol III (H1) promoter
TagsSV40NLSExpressionMammalianMutationHEK4 donor, a1/a2 length extended for 27 bpPromoterH1Available SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV.CBA.YFP.miR-E_shSrpk3-2
Plasmid#180401PurposeProducing AAV that encodes mouse Srpk3 shRNA-2 with miR-E backboneDepositorAvailable SinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV.CBA.YFP.miR-E_shStk16-3
Plasmid#180393PurposeProducing AAV that encodes mouse Stk16 shRNA-2 with miR-E backboneDepositorAvailable SinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
E42_gRunx3_gRNA3_dTet_mTurquoise2
Plasmid#189806PurposeRetroviral delivery of guide RNA against mouse Runx3DepositorInsertgRunx3_gRNA3 (Runx3 Mouse)
UseRetroviralAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
E42_gRunx3_gRNA1_dTet_mTurquoise2
Plasmid#189804PurposeRetroviral delivery of guide RNA against mouse Runx3DepositorInsertgRunx3_gRNA1 (Runx3 Mouse)
UseRetroviralAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-v2-ALDH1A3gRNA1
Plasmid#189746PurposeThe construct was used for expression of gRNA and Cas9 for knocking out of the ALDH1A3 gene.DepositorInsertCas9, ALDH1A3 gRNA
UseCRISPRPromoterU6Available SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1G2
Plasmid#188965PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA 1: atcggtcgcattgttttccactagg, sgRNA 2: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
hu6-sgCebpd_v2 (opti)
Plasmid#177250PurposeSame as pLL3.3;U6(BstXI)-XhoI-chimeric RNA;PGK-Cre but XhoI stuffer removed, expresses Cebpd gRNADepositorInsertsgCebpd_2nd
UseLentiviralPromoterhU6Available SinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
mU6-sgCebpa_v1-hu6-sgCebpb_v1
Plasmid#177251PurposeExpresses Cebpa_v1 (mU6), Cebpb_v1 (hU6) gRNAs and Cre-recombinaseDepositorInsertsgCebpa_v1/sgCebpb_v1
UseLentiviralPromotermU6/hU6Available SinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
mU6-sgCebpa_v2-hu6-sgCebpb_v2
Plasmid#177252PurposeExpresses Cebpa_v2 (mU6), Cebpb_v2(hU6) gRNAs and Cre-recombinaseDepositorInsertsgCebpa_v2/sgCebpb_v2
UseLentiviralPromotermU6/hU6Available SinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only