We narrowed to 6,451 results for: siae
-
-
-
-
-
pAM245
Plasmid#226889Purpose6xHis-PSP-GS-PANN(75-150)-(5aaGS)-Msp1(36-362)DepositorAvailable SinceNov. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
-
pRSII41N-TDH3pr-mNeon
Plasmid#194536PurposeLow copy vector backbone with nourseothricin selectivity, encodes for TDH3(pr) driven expression of mNeonDepositorInsertnatAC
ExpressionYeastPromoterTDH3Available SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRSII42N-TDH3pr-mNeon
Plasmid#194537PurposeHigh copy vector backbone with nourseothricin selectivity, encodes for TDH3(pr) driven expression of mNeonDepositorInsertnatAC
ExpressionYeastPromoterTDH3Available SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRSII41H-TDH3pr-mNeon
Plasmid#194538PurposeLow copy vector backbone with hygromycin B selectivity, encodes for TDH3(pr) driven expression of mNeonDepositorInserthphMX
ExpressionYeastPromoterTDH3Available SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRSII41K-TDH3pr-mNeon
Plasmid#194534PurposeLow copy vector backbone with G418 selectivity, encodes for TDH3(pr) driven expression of mNeonDepositorInsertkanMX
ExpressionYeastPromoterTDH3Available SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRSII42K-TDH3pr-mNeon
Plasmid#194535PurposeHigh copy vector backbone with G418 selectivity, encodes for TDH3(pr) driven expression of mNeonDepositorInsertkanMX
ExpressionYeastPromoterTDH3Available SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SEC18-L1374
Plasmid#226275PurposePlasmid expressing the SEC18 allele from L-1374, under control of its native promoterDepositorInsertSEC18 (SEC18 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SEC18-S288C
Plasmid#226274PurposePlasmid expressing the SEC18 allele from S288C, under control of its native promoterDepositorInsertSEC18 (SEC18 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SEC18-NCYC110
Plasmid#226277PurposePlasmid expressing the SEC18 allele from NCYC110, under control of its native promoterDepositorInsertSEC18 (SEC18 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SEC18-UWOPS872421
Plasmid#226276PurposePlasmid expressing the SEC18 allele from UWOPS87-2421, under control of its native promoterDepositorInsertSEC18 (SEC18 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS313-SCT1-L1374
Plasmid#226267PurposePlasmid expressing the SCT1 allele from L-1374, under control of its native promoterDepositorInsertSCT1 (SCT1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-LUG1
Plasmid#226265PurposePlasmid expressing Cas9 and gRNA TCTTCAAGTTACTCCAAGAG which targets the LUG1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#226263PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS313-SCT1-NCYC110
Plasmid#226269PurposePlasmid expressing the SCT1 allele from NCYC110, under control of its native promoterDepositorInsertSCT1 (SCT1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS313-SCT1-UWOPS872421
Plasmid#226268PurposePlasmid expressing the SCT1 allele from UWOPS87-2421, under control of its native promoterDepositorInsertSCT1 (SCT1 Budding Yeast)
ExpressionYeastAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJJB170
Plasmid#218591PurposeExpress engineered TFs Adr1c(S230A), Pip2c, and Oaf1cDepositorInsertAdr1
ExpressionYeastMutationAdr1(S230A), Pip2(1-168 + 2,497-2,988), Oaf1(1-30…Available SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJJB1340
Plasmid#218593PurposeExpress a red fluorescent protein to the peroxisome membrane via tethering to a truncated Pex22. Also overexpresses Pex11DepositorInsertPex22
ExpressionYeastMutationPex22(1-36)Available SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAM284
Plasmid#226122PurposeExpression of cdc48 E588QDepositorAvailable SinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
pAM289
Plasmid#226126PurposeExpression of Npl4 D460K/Y461ADepositorAvailable SinceSept. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
paM291
Plasmid#226128PurposeExpression of His6-GST-3C-Npl4 T255A/T571ADepositorAvailable SinceSept. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAM288
Plasmid#226125PurposeExpression of Npl4 W252A/R253EDepositorAvailable SinceSept. 24, 2024AvailabilityAcademic Institutions and Nonprofits only