We narrowed to 10,944 results for: NSI
-
Plasmid#106426PurposeH-RAN-RFP6 (RANbody RFP6::Sm-HAtag)DepositorInsertH-RAN-RFP6
UseTagsHA, His, and Multiple HAExpressionMammalianMutationPromoterAvailable sinceFeb. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET26-CNTnw
Plasmid#100163Purposerecombinant expression of target protein as an MBP-His tag fusion at the N-terminus of target proteinDepositorInsertConcentrative nucleoside transporter
UseTagsMBP-HisExpressionBacterialMutationPromoterT7Available sinceOct. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
pJK220
Plasmid#71123PurposeExpression of E. coli pantotheinate kinase (H6PanK, R175H mutant) in E. coliDepositorInsertpantothenate kinase
UseTagsH6ExpressionBacterialMutationArg175 is mutated to a HisPromoterT7Available sinceJan. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO.puro_shHuR 3UTR
Plasmid#110414PurposeTRCN0000276186 (Target TTGTTAGTGTACAACTCATTT), silence human ELAVL1 (HuR) gene, puromycin selectionDepositorInsertELAVL1 (HuR)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterU6 (RNA PolIII)Available sinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T-1-3xHA-IκBα(1-62)
Plasmid#129226PurposeEncodes HA tagged human IκBα(1-62) for purification by GST affinityDepositorInsertIkBa(1-62) (NFKBIA Human)
UseTagsGST and HAExpressionBacterialMutationPromoterAvailable sinceJan. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHJ1_Full length LexA
Plasmid#107237PurposesfGFP expression repressed by transcriptional factor LexADepositorInsertFull length LexA repressor
UseSynthetic BiologyTagsExpressionMutationPromoterpLacO1Available sinceMay 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYCTK009
Plasmid#176713PurposeThe plasmid is part of a GG toolkit for cell-cell communication in S. cerevisiae. This plasmid is an L0 part plasmid and contains the alpha-factor gene of Eremothecium cymbalariae (sender part).DepositorArticleInsertmfalpha1Ec
UseSynthetic BiologyTagsExpressionMutationCodon-optimized for expression in S. cerevisiaePromoterAvailable sinceJan. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYCTK020
Plasmid#176724PurposeThe plasmid is part of a GG toolkit for cell-cell communication in S. cerevisiae. This plasmid is an L0 part plasmid and contains the Ste2 gene of Eremothecium cymbalariae (receiver part).DepositorArticleInsertste2Ec
UseSynthetic BiologyTagsExpressionMutationCodon-optimized for expression in S. cerevisiaePromoterAvailable sinceJan. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYCTK030
Plasmid#176734PurposeThe plasmid is part of a GG toolkit for cell-cell communication in S. cerevisiae. This plasmid is an L0 part plasmid and contains the Bar1 gene of Candida albicans (barrier part).DepositorArticleInsertbar1Ca
UseSynthetic BiologyTagsExpressionMutationCodon-optimized for expression in S. cerevisiaePromoterAvailable sinceJan. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYCTK031
Plasmid#176735PurposeThe plasmid is part of a GG toolkit for cell-cell communication in S. cerevisiae. This plasmid is an L0 part plasmid and contains the Bar1 gene of Eremothecium cymbalariae (barrier part).DepositorArticleInsertbar1Ec
UseSynthetic BiologyTagsExpressionMutationCodon-optimized for expression in S. cerevisiaePromoterAvailable sinceJan. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYCTK008
Plasmid#176712PurposeThe plasmid is part of a GG toolkit for cell-cell communication in S. cerevisiae. This plasmid is an L0 part plasmid and contains the alpha-factor gene of Candida albicans (sender part).DepositorArticleInsertmfalpha1Ca
UseSynthetic BiologyTagsExpressionMutationCodon-optimized for expression in S. cerevisiaePromoterAvailable sinceJan. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-H-RAN-H2A2B
Plasmid#106419PurposeH-RAN-H2A2B (RANbody H2A2B::Sm-HAtag)DepositorInsertH-RAN-H2A2B
UseTagsHA, His, and Multiple HAExpressionMammalianMutationPromoterAvailable sinceFeb. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBT225_(pCA-tdT3Myc)
Plasmid#36873DepositorInserttdTomato-3Myc
UseTags3 Myc tagsExpressionMammalianMutationPromoterCAG (chicken beta actin promoter and CMV enhancer)Available sinceJuly 23, 2012AvailabilityAcademic Institutions and Nonprofits only -
pRSETA_crE6
Plasmid#172928PurposeCrowding FRET sensor with mCerulean3 and mCitrine for E. coli expression. Linker comprises 1 helix and 2 GSG linkersDepositorInsertCrowdingSensorE6
UseTagsHisExpressionBacterialMutationPromoterT7Available sinceAug. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
RaCCR1_EYFP_pcDNA3.1
Plasmid#159122PurposeThis plasmid encodes RaCCR1 rhodopsin domainDepositorInsertRaCCR1
UseTagsEYFPExpressionMammalianMutationPromoterAvailable sinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJLI-sup35
Plasmid#1210DepositorInsertsup35 5' and 3' flanking regions (SUP35 Budding Yeast)
UseTagsExpressionYeastMutationsup35 gene is not included in this plasmid. Only…PromoterAvailable sinceMay 25, 2005AvailabilityAcademic Institutions and Nonprofits only -
pGL-Rbl1UTR
Plasmid#20884DepositorInsertRbl1 (p107) 3'UTR (Rbl1 Mouse)
UseLuciferaseTagsExpressionMammalianMutationPromoterAvailable sinceAug. 5, 2009AvailabilityAcademic Institutions and Nonprofits only -
pCMV-M-RAN-RFP6
Plasmid#106428PurposeM-RAN-RFP6 (RANbody RFP6::Sm-MYCtag)DepositorInsertM-RAN-RFP6
UseTagsHA, His, and Multiple MYCExpressionMammalianMutationPromoterAvailable sinceFeb. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
ROPY-2C2
Plasmid#128004PurposeLocal FRET-readout of membrane-anchored Stathmin/OP18 interaction with α-tubulinDepositorInsertROPY-2C2
UseTagsExpressionMammalianMutationPromoterAvailable sinceOct. 23, 2020AvailabilityAcademic Institutions and Nonprofits only