We narrowed to 16,430 results for: grn
-
Plasmid#236203Purposelentiviral expression of Cas9 and encodes CT6 sgRNA for CLEC12A deletionDepositorAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only
-
sgRNA Clec12a (CT44)
Plasmid#236204Purposelentiviral expression of Cas9 and encodes CT44 sgRNA for CLEC12A deletionDepositorAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
sgRNA Clec12a (CT47)
Plasmid#236205Purposelentiviral expression of Cas9 and encodes CT47 sgRNA for CLEC12A deletionDepositorAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458_mCherry-HP1a-gRNA-2
Plasmid#237635PurposeCas9 from S. pyogenes with 2A-mCherry, gRNA to knock-in msfGFP to HP1a locusDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458_mCherry-HP1a-gRNA-1
Plasmid#237634PurposeCas9 from S. pyogenes with 2A-mCherry, gRNA to knock-in msfGFP to HP1a locusDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458_mCherry-TCOF1-gRNA
Plasmid#237633PurposeCas9 from S. pyogenes with 2A-mCherry, gRNA to knock-in msfGFP to TCOF1 locusDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458_mCherry-FUS-gRNA
Plasmid#237685PurposeCas9 from S. pyogenes with 2A-mCherry, gRNA to knock-in msfGFP to FUS locusDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
Halo XLF sgRNA
Plasmid#207605PurposesgRNA for the insert of the HaloTag at the endogenous loci of XLFDepositorInsertGTTCTTCCATctgcaaaaaa
TagsNoneExpressionMammalianAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX458-eBFP2-sgRNA_CTCF_ZF1
Plasmid#233090PurposeExpression vector for a sgRNA against the mouse CTCF ZF1 region and SpCas9-T2A-eBFP2.DepositorInsertspCas9-T2A-eBFP2 (Ctcf )
ExpressionMammalianAvailable SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCBE-dGFP-gRNA
Plasmid#226862PurposeHuman gRNA expression vector targeting the Y93H mutation of non-fluorescent EGFP in plasmid pCBE-dGFP; for use with CBEsDepositorInsertSp-gRNA
ExpressionMammalianPromoterhU6Available SinceFeb. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
gRNA giantin/GOLGB1
Plasmid#222315PurposeCRISPR/Cas9 close to the ATG of giantin/GOLGB1 gene.DepositorInsertgRNA targeting GOLB1 (GOLGB1 Human)
UseCRISPRAvailable SinceFeb. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-nucGFP11-3xPax7gRNA
Plasmid#224570PurposeUbiquitous expression plasmid, CAG promoter (CMV immediate early enhancer, chicken beta actin promoter), three unique Pax7 gRNAs with ribozyme self-cleavage sites, and nuclear split GFP(11) reporter.DepositorInsertGFP11-H2B
UseCRISPRTagsHistone H2B (nuclear localization)MutationCodon optimizedAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTBL3401 BtoApegRNA-sfGFP
Plasmid#226667PurposePiggyBac cargo vector encoding B to A pegRNA marked with sfGFPDepositorInsertBtoA pegRNA
UseCRISPRExpressionMammalianPromoterhU6Available SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pICH86966::AtU6p::sgRNA:NbVPE1a/b
Plasmid#223218PurposeExpresses an sgRNA targeting the NbVPE1a/b genes in Nicotiana benthamiana with an Arabidopsis U6 promoterDepositorInsertNbVPE1a/b
UseCRISPR and Synthetic BiologyTagsNoneExpressionPlantPromoterArabidopsis U6 promoterAvailable SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pICH86966::AtU6p::sgRNA:NbCysP6
Plasmid#223217PurposeExpresses an sgRNA targeting the NbCysP6 gene in Nicotiana benthamiana with an Arabidopsis U6 promoterDepositorInsertNbCysP6 sgRNA
UseCRISPR and Synthetic BiologyTagsNoneExpressionPlantPromoterArabidopsis U6 promoterAvailable SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
FgH1tUTG-sgRNA.FOXA-ZEB2_CRISPRd
Plasmid#216170PurposeExpress the gRNA targeting the FOXA-binding site in the human ZEB2 locus for the CRISPRd experimentDepositorInsertsgRNA- FOXA.bs- ZEB2.locus
UseLentiviralTagsEGFPAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
FgH1tUTG-sgRNA.PRDM1-ZEB2_CRISPRd
Plasmid#216171PurposeExpress the gRNA targeting the PRDM1-binding site in the human ZEB2 locus for the CRISPRd experimentDepositorAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
FgH1tUTG-sgRNA.Control-ZEB2_CRISPRd
Plasmid#216172PurposeExpress the gRNA targeting the control site in the human ZEB2 locus for the CRISPRd experimentDepositorInsertsgRNA- Control- ZEB2.locus
UseLentiviralTagsEGFPAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
LRG-sgRNA.FOXA-ZEB2_CRISPRd_v2
Plasmid#216173PurposeExpress the gRNA targeting the FOXA-binding site in the human ZEB2 locus for the CRISPRd experimentDepositorInsertsgRNA- FOXA.bs- ZEB2.locus
UseLentiviralTagsEGFPAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only