We narrowed to 15,273 results for: grn
-
Plasmid#122334PurposeExpresses sgRNA targeting mouse Dnmt3b and Cas9 nickase in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA for mouse Dnmt3b
ExpressionMammalianAvailable sinceJune 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA as2
Plasmid#132394PurposeTargets AAVS1 intron 1, gRNA: AGAACCAGAGCCACATTAAC, MLM3636 backboneDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA targeting AAVS1 intron 1 (PPP1R12C Human)
UseCRISPRExpressionMammalianPromoterhU6Available sinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
p1192-scAAV-U6-sgRNA_Nme2Cas9_Rosa26-CB-PI-AcrIIC3Nme_FLAG_NLS
Plasmid#129530PurposeSelf-complementary AAV vector expressing Nme2Cas9 sgRNA targeting Rosa26 and AcrIIC3NmeDepositorInsertscodon-optimized AcrIIC3Nme
sgRNA_Rosa26
UseAAVTagsFLAG/NLSPromoterU6 and cytomegalovirus-enhancer chicken β-actin p…Available sinceOct. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Nprl2-g1)-PGKpuroBFP-W
Plasmid#105037PurposeLentiviral gRNA plasmid targeting mouse Nprl2 , co-expression of TagBFPDepositorAvailable sinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Nprl2-g2)-PGKpuroBFP-W
Plasmid#105038PurposeLentiviral gRNA plasmid targeting mouse Nprl2 , co-expression of TagBFPDepositorAvailable sinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Stk11)-PGKpuroBFP-W
Plasmid#105043PurposeLentiviral gRNA plasmid targeting mouse Stk11 , co-expression of TagBFPDepositorAvailable sinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Nelfb-g1)-PGKpuroBFP-W
Plasmid#105023PurposeLentiviral gRNA plasmid targeting mouse Nelfb , co-expression of TagBFPDepositorAvailable sinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Nelfb-g2)-PGKpuroBFP-W
Plasmid#105024PurposeLentiviral gRNA plasmid targeting mouse Nelfb , co-expression of TagBFPDepositorAvailable sinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Nelfcd-g1)-PGKpuroBFP-W
Plasmid#105025PurposeLentiviral gRNA plasmid targeting mouse Nelfcd , co-expression of TagBFPDepositorAvailable sinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Nelfcd-g2)-PGKpuroBFP-W
Plasmid#105026PurposeLentiviral gRNA plasmid targeting mouse Nelfcd , co-expression of TagBFPDepositorAvailable sinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV Gsk3 sgRNA/GFP
Plasmid#112733PurposeGsk3b targeting gRNA cloned into px552 (SpGuide) plasmid.DepositorInsertGFP
UseAAV and CRISPRExpressionMammalianAvailable sinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
gRNAs[bTub+Sxl].1046B
Plasmid#112692Purposeexpress two gRNA targeting bTub & Sxl under dU6-3 promoterDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertU6.3-gRNA[bTub] and U6.3-gRNA[Sxl] (Sxl Fly)
UseCRISPRAvailable sinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pENTR-PpU6P-sgRNA-R4R3
Plasmid#113739PurposeGateway entry vector containing attR4 and attR3 sites, U6 promoter, BsaI sites for protospacer ligation, and sgRNA.DepositorInsertPpU6P::sgRNA
UseCRISPR and Gateway CloningPromoterP. patens U6 promoterAvailable sinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pENTR-PpU6P-sgRNA-L5L4
Plasmid#113741PurposeGateway entry vector containing attL5 and attL4 sites, U6 promoter, BsaI sites for protospacer ligation, and sgRNA.DepositorInsertPpU6P::sgRNA
UseCRISPR and Gateway CloningPromoterP. patens U6 promoterAvailable sinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pENTR-PpU6P-sgRNA-L1R5
Plasmid#113737PurposeGateway entry vector containing attL1 and attR5 sites, U6 promoter, BsaI sites for protospacer ligation, and sgRNA.DepositorInsertPpU6P::sgRNA
UseCRISPR and Gateway CloningPromoterP. patens U6 promoterAvailable sinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pUC57-Sa sgRNA expression vector
Plasmid#107720PurposeFor in vitro transcription of Sa sgRNA from the T7 promoter.DepositorTypeEmpty backboneUseCRISPRAvailable sinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
p426-SNR52p-gRNA.clr-2.Y-SUP4t
Plasmid#89692PurposegRNA for clr-2 locusDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA for clr-2 locus
UseCRISPR; GrnaTagsNoAvailable sinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHU6_chr12_FAM19A2-down-gRNA-rev
Plasmid#81222PurposepHu6-gRNA-NT1_SpecR backbone, gRNA for targeting the downstream region of FAM19A2 locusDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthU6 expression of gRNA
ExpressionMammalianPromoterU6Available sinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
tRNA-gRNA position [n] (GB1207)
Plasmid#75408PurposetRNA and scaffold for the assembly of GBoligomers for the last position (positon [n]) of a polycistronic tRNA-gRNA (2- and 3-part multiplexing)DepositorInserttRNA-gRNA position [n]
UseCRISPR and Synthetic BiologyExpressionPlantAvailable sinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - Amplicon, JAK2 sgRNA 2
Plasmid#70660PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an intergenic JAK2 amplicon-targeting sgRNA element from U6 promoter. Lentiviral backboneDepositorPublicationInsertsgRNA against JAK2 amplicon found in AML-derived HEL cell line (JAK2 )
UseCRISPR and LentiviralExpressionMammalianAvailable sinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only