We narrowed to 4,010 results for: biorxiv
-
Plasmid#221827PurposePlasmid to express gRNA1 (ttcagtttgcccggtttaac) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pdU6-2_sgRNA2-d5-HT2BR
Plasmid#221828PurposePlasmid to express gRNA2 (aggcactcgtgctcgaatag) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTwist Amp_d5-HT2AR(isoformD)-7xsfGFP11-HA-HDR-donor
Plasmid#221838PurposeDonor plasmid for inserting 7xGFP11-HA at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsert7xGFP11-HA donor with 5-HT2AR (isoform D) homology arms
UseCRISPRExpressionInsect and MammalianAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTwist Amp_d5-HT2AR(isoformBFH)-7xsfGFP11-HA-HDR-donor
Plasmid#221839PurposeDonor plasmid for inserting 7xGFP11-HA at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsert7xGFP11-HA donor with 5-HT2AR (isoforms BFH) homology arms
UseCRISPRExpressionInsect and MammalianAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pACUH 5-HT2BR-7xGFP11-HA
Plasmid#221840PurposePlasmid for generating 10xUAS-5-HT2BR-7xGFP11-HA transgenic flies with attP/attB integration. It carries the attB sequence.DepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV5-NUP98n-CAGEn-NES (Nrdj1)
Plasmid#241418PurposeProximity-triggered Protein Trans-Splicing to generate the splice product MLL-AF9, Figure 2 & Extended Figure 4 in Nature Chemical Biology 20.10 (2024): 1353-1360.DepositorAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pL6puro-pSV40(3)-pmRevErbA-Venus-NLS-Pest
Plasmid#240114PurposeA lentiviral (yellow) fluorescent reporter of circadian rhythm, based on the murine Nr1d1-gene (REVERBa protein), expression enhanced by SV40 promoter fragment.DepositorInsertmurine Nr1d1 promoter+Venus-NLS-Pest-Reporter (Nr1d1 Mouse)
UseLentiviralMutationadded SV40-EnhancerAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pL6puro-pSV40(4)-pmRevErbA-Venus-NLS-Pest
Plasmid#240115PurposeA lentiviral (yellow) fluorescent reporter of circadian rhythm, based on the murine Nr1d1-gene (REVERBa protein), expression enhanced by SV40 promoter.DepositorInsertmurine Nr1d1 promoter+Venus-NLS-Pest-Reporter (Nr1d1 Mouse)
UseLentiviralMutationadded SV40-Enhancer+OriAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pL6puro-pSV40(2)-pmRevErbA-Venus-NLS-Pest
Plasmid#240113PurposeA lentiviral (yellow) fluorescent reporter of circadian rhythm, based on the murine Nr1d1-gene (REVERBa protein), expression enhanced by SV40 promoter.DepositorInsertmurine Nr1d1 promoter+Venus-NLS-Pest-Reporter (Nr1d1 Mouse)
UseLentiviralMutationadded SV40-Enhancer+OriAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pL6puro-pSV40(3)-pmRevErbA-mScaI3-NLS-Pest
Plasmid#240117PurposeA lentiviral (red) fluorescent reporter of circadian rhythm, based on the murine Nr1d1-gene (REVERBa protein), expression enhanced by SV40 promoter fragment.DepositorInsertmurine Nr1d1 promoter+mScarlet-I3-NLS-Pest-Reporter (Nr1d1 Mouse)
UseLentiviralMutationadded SV40-EnhancerAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pL6puro-pSV40(4)-pmRevErbA-mScaI3-NLS-Pest
Plasmid#240118PurposeA lentiviral (red) fluorescent reporter of circadian rhythm, based on the murine Nr1d1-gene (REVERBa protein), expression enhanced by SV40 promoter.DepositorInsertmurine Nr1d1 promoter+mScarlet-I3-NLS-Pest-Reporter (Nr1d1 Mouse)
UseLentiviralMutationadded SV40-Enhancer+OriAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPOTv7-hyg-OsAID (p5110)
Plasmid#239360PurposepPOTv7 based plasmid template for addition of a Rice Auxin Inducible Degradation (AID) domain to genes in trypanosomes with selection using hygromycinDepositorInsertsRice Auxin Inducible Degradation domain
Auxin Inducible Degradation domain
UseBacterialPromoternoneAvailable SinceJuly 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPOTv6-puro-3Ty:OsAID:3Ty (p5229)
Plasmid#239361PurposepPOTv6 based plasmid template for addition of Ty-epitope tagged Rice Auxin Inducible Degradation (AID) domain to genes in trypanosomes with selection using puromycinDepositorInsertRice Auxin inducible degradation domain
UseBacterialTags3 x Ty epitope tagPromoternoneAvailable SinceJuly 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPOTv6-hyg-3Ty:OsAID:3Ty (p5230)
Plasmid#239362PurposepPOTv6 based plasmid template for addition of Ty-epitope tagged Rice Auxin Inducible Degradation (AID) domain to genes in trypanosomes with selection using puromycinDepositorInsertRice Auxin inducible degradation domain
UseBacterialTags3 x Ty epitope tagPromotern/aAvailable SinceJuly 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUBC(k)-AT5G05380-mKOk
Plasmid#224849PurposePlasmid for expression of AT5G05380.1 coding sequence tagged with mKOk in plantsDepositorInsertAT5G05380.1 (PRA1.B3 Mustard Weed)
ExpressionPlantAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUBC(k)-AT5G07110-mKOk
Plasmid#224850PurposePlasmid for expression of AT5G07110.1 coding sequence tagged with mKOk in plantsDepositorInsertAT5G07110.1 (PRA1.B6 Mustard Weed)
ExpressionPlantAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUBC(k)-AT5G16830-mKOk
Plasmid#224851PurposePlasmid for expression of AT5G16830.1 coding sequence tagged with mKOk in plantsDepositorInsertAT5G16830.1 (SYP21 Mustard Weed)
ExpressionPlantAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUBC(k)-AT5G59420-mKOk
Plasmid#224855PurposePlasmid for expression of AT5G59420.1 coding sequence tagged with mKOk in plantsDepositorInsertAT5G59420.1 (ORP3C Mustard Weed)
ExpressionPlantAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUBC(k)-AT5G65020.1-mKOk
Plasmid#224856PurposePlasmid for expression of AT5G65020.1 coding sequence tagged with mKOk in plantsDepositorInsertAT5G65020.1 (ANNAT2 Mustard Weed)
ExpressionPlantAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUBC(k)-AT5G65020.2-mKOk
Plasmid#224857PurposePlasmid for expression of AT5G65020.2 coding sequence tagged with mKOk in plantsDepositorInsertAT5G65020.2 (ANNAT2 Mustard Weed)
ExpressionPlantAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only