We narrowed to 2,606 results for: EXO
-
Plasmid#239305PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting EXOSC7DepositorInsertU6-driven sgRNA targeting EXOSC7 (EXOSC7 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_EXOSC8 (pP18(T)_B1-AVA4071)
Plasmid#239306PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting EXOSC8DepositorInsertU6-driven sgRNA targeting EXOSC8 (EXOSC8 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_EXOSC9 (pP18(T)_A7-AVA4072)
Plasmid#239307PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting EXOSC9DepositorInsertU6-driven sgRNA targeting EXOSC9 (EXOSC9 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_EXOSC2 (pP18(T)_C3-AVA4067)
Plasmid#239301PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting EXOSC2DepositorInsertU6-driven sgRNA targeting EXOSC2 (EXOSC2 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_EXOSC4 (pP18(T)_C11-AVA4065)
Plasmid#239302PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting EXOSC4DepositorInsertU6-driven sgRNA targeting EXOSC4 (EXOSC4 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_sgRNA_EXOSC5 (pP18(T)_B12-AVA4068)
Plasmid#239303PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and an sgRNA targeting EXOSC5DepositorInsertU6-driven sgRNA targeting EXOSC5 (EXOSC5 Human)
UseCRISPR and LentiviralAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2puro-E-cadherin(Canis)-exon1 6-28 gRNA
Plasmid#209922PurposeA knock-out vector for the dog CDH1DepositorInsertA gRNA targeting the dog CDH1 gene.
UseCRISPR and LentiviralAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
Anti-TRIP8b (exon 1b) [N212A/34R-2b]
Plasmid#225413PurposeMammalian Expression Plasmid of anti-TRIP8b (exon 1b) (Mouse) IgG2b R-mAb. Derived from hybridoma N212A/34.DepositorInsertAnti-TRIP8b (exon 1b) (Mus musculus) recombinant (Mouse) monoclonal antibody. (Pex5l Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
Anti-TRIP8b (exon 1a-5) [N291A/43R]
Plasmid#225389PurposeMammalian Expression Plasmid of anti-TRIP8b (exon 1a-5) (Mouse) IgG2a R-mAb. Derived from hybridoma N291A/43.DepositorInsertAnti-TRIP8b (exon 1a-5) (Mus musculus) recombinant (Mouse) monoclonal antibody. (Pex5l Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
Anti-MFF (exon 1) [N382/69R]
Plasmid#206565PurposeMammalian Expression Plasmid of anti-MFF (exon 1) (Human). Derived from hybridoma N382/69.DepositorInsertanti-MFF (exon 1) (Homo sapiens) recombinant Mouse monoclonal antibody (MFF Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceNov. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
lenti-Cas9-Exo-Blast-BFP
Plasmid#196721PurposeSortable and selectable SpCas9 fused to exodeoxyribonuclease I (sbcB) from E. coli. For the creation of longer deletions.DepositorInsertCas9-Exo1-T2A-BSD-TagBFP
UseCRISPR and LentiviralTagsNucleoplasmin NLS and SV40 NLSPromoterEF1aAvailable SinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
Anti-TRIP8b (exon 1b) [N212A/34R]
Plasmid#182108PurposeMammalian Expression Plasmid of anti-TRIP8b (exon 1b) (Mouse). Derived from hybridoma N212A/34.DepositorInsertanti-TRIP8b (exon 1b) (Mus musculus) recombinant mouse monoclonal antibody (Pex5l Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-3exo-Tetra-com-CLCN5-sp-g1
Plasmid#176236PurposePlasmid for expressing a fusion protein of spCas9 and the 3’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
ExpressionBacterialAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-5Exo-tetra-com-hCLCN5-sp-g1
Plasmid#176237PurposePlasmid for expressing a fusion protein of spCas9 and the 5’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
ExpressionBacterialAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-Exo-tetra-com-hCLCN5-sp-g1
Plasmid#176238PurposePlasmid for expressing a fusion protein of spCas9 and the 5’ and 3’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
ExpressionBacterialAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRPL28exon1-(Nhe/Mfe) SpHIS5 (pNTI619)
Plasmid#115432PurposeVector for expressing RPL28 with mutagenized exon2DepositorInsertsExpressionYeastMutationexon 2 deleted, with MfeI / NheI cloning sitePromoterAshbya gospii TEF1 and endogenousAvailable SinceOct. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
Anti-TRIP8b (exon 1a/5) [N291C/22R]
Plasmid#114563PurposeMammalian Expression Plasmid of anti-TRIP8b (exon 1a/5) (Mouse). Derived from hybridoma N291C/22.DepositorInsertanti-TRIP8b (exon 1a/5) (Mus musculus) recombinant mouse monoclonal antibody (Pex5l Mouse)
ExpressionMammalianPromoterdual CMVAvailable SinceSept. 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC57 DYSF, alt exon 1, 40a
Plasmid#87894Purposeresearch of alternative isoforms of the protein dysferlinDepositorInsertDYSF, alt exon 1, 40a (DYSF Human)
ExpressionBacterialMutationalternative isoforms, see commentsAvailable SinceApril 28, 2017AvailabilityAcademic Institutions and Nonprofits only