We narrowed to 3,165 results for: bad
-
Plasmid#166128PurposeExpression of human talin-1 head (residues 1-405) in E. coli. Contains 30 amino acid deletion in F1-loop. N-terminal His6-tag, Xpress-epitope (DLYDDDDK) and enterokinase cleavage site for tag removal.DepositorInsertT1head1-405(del30) (TLN1 Human)
TagsHis6-tag, Xpress-epitope (DLYDDDDK) and enterokin…ExpressionBacterialMutationresidues 1-405, with 30 amino acid deletion in th…Available SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
t1-405(T144E,T150E)
Plasmid#166130PurposeFor expression of human talin-1 head (residues 1-405) in E. coli. Includes mutations T144E and T150E. N-terminal His6-tag, Xpress-epitope (DLYDDDDK) and enterokinase cleavage site for tag removal.DepositorInsertHuT1head1-405(T144E,T150E) (TLN1 Human)
TagsHis6-tag, Xpress-epitope (DLYDDDDK) and enterokin…ExpressionBacterialMutationresidues 1-405, mutations T144E and T150EAvailable SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_HSD17B10_WT_V5
Plasmid#82941PurposeGateway Donor vector containing HSD17B10, used as an over expression control for gene expression analysis. Part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
MB 93C1 thsS(t3)R-Bxb1_P7-bARGSer
Plasmid#232469PurposeOptimized thiosulfate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
t1-405(151-154AAAA)
Plasmid#166131PurposeExpression of human talin-1 head (aa1-405) in E. coli. Four substitutions in the F1-loop (aa151-154 all mutated to Al). N-terminal His6-tag, Xpress-epitope (DLYDDDDK) and enterokinase cleavage site.DepositorInsertT1head1-405(151-154AAAA) (TLN1 Human)
TagsHis6-tag, Xpress-epitope (DLYDDDDK) and enterokin…ExpressionBacterialMutationaa1-405 only. Contains 4 amino acid substitutions…Available SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only