We narrowed to 3,364 results for: zebrafish
-
Plasmid#208688PurposeExpresses the genetically-encoded fluorescent norepinephrine (NE) sensor GRAB_NE2m pan-neuronally in zebrafishDepositorInsertGPCR activation based norepinephrine (NE) sensor GRAB_NE2m
UseCloning vectorPromoterHucAvailable SinceOct. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pACYC-T7-SpCas9-T7-EGFP_gRNA1-T7term (BPK848)
Plasmid#181745Purposedual T7 promoter vector for bacterial expression of SpCas9 with a c-terminal NLS and 3xFLAG tag, along with an SpCas9 sgRNA targeting EGFP site 1DepositorInserthuman/zebrafish codon optimized SpCas9
UseIn vitro transcription; t7 promoterTagsNLS(SV40)-3xFLAGExpressionBacterialPromoterT7Available SinceFeb. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
neurod1:cre; cmlc2:EGFP
Plasmid#173480Purposecre is driven by -5kb neurod1 promoter. The vector contain a cmlc2:EGFP makerDepositorInsertCre
UseZebrafish expressionAvailable SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
neurod1:Gal4; cmlc2:EGFP
Plasmid#173478PurposeGal4 is driven by -5kb neurod1 promoter. The vector contains a cmlc2:EGFP markerDepositorInsertGal4
UseZebrafish expressionAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
Tg(Sox17::EMTB-3xGFP)
Plasmid#221190PurposeTo specifically label microtubules (MTs) in Kupffer's Vesicle (KV)DepositorInsertEnsconsin Microtubule-Binding Protein (MAP7 Human)
UseZebrafishTags3 EGFPMutationMicrotubule binding-domain of ensconsin (A.A. 18…PromoterSox17Available SinceJune 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
mKate2-DrCavin1b in pT3TS-Dest
Plasmid#194295PurposeIn vitro transcription of mKate2 tagged zebrafish cavin1b from the T3 promoter. The red fluorescent tag is at the N-terminus. Parton lab clone LACDepositorInsertcavin1b (cavin1b Zebrafish)
UseIn vitro transcription of mrnaAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCS2+ Zf ctnna1L344P
Plasmid#185407PurposeZebrafish ctnna1 bearing a point mutation in the vinculin binding site. For in vitro transcription (SP6) or expression through CMVDepositorInsertctnna1 (ctnna1 Zebrafish)
UseIn vitro synthesis of mrnaExpressionMammalianMutationchanged Leucine 344 to ProlineAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
p3E-CDC42-DN
Plasmid#109584PurposeMultisite gateway vector for 3' tagging with dominant negative CDC42DepositorAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
p3E-DrCav1
Plasmid#194290PurposeMultisite gateway entry clone for expression of codon optimised zebrafish caveolin1 with fusion tag at the N-terminus. Parton lab clone KRTDepositorInsertcaveolin1 (cav1.S Frog)
UseMultisite gateway entry vectorAvailable SinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCS2+ cMyc-oDam_f_GFPoNLS
Plasmid#85818PurposeiDamID plasmid. To express transiently the c-Myc-tagged and optimized E. coli Dam adenine methyltransferase fused to the nuclear-localized mmGFP via flexylinker.DepositorInsertcMyc oDam_f_GFPoNLS
TagscMyc and oNLS (optimized nuclear localization sig…ExpressionBacterial, Insect, Mammalia…MutationL122A. Codon optimization compatible to work in M…Available SinceJan. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
CmCitrine Lck w/ NosUTRs
Plasmid#66785Purposeexpression of fluorescent membranes in sea urchin primordial germ cellsDepositorInsertLck (LCK Human)
UseSea urchin, zebrafish, xenopusTags3' UTR from sea urchin Nanos, 5' UTR fr…MutationTandem repeat of LCK the N-terminal membrane targ…PromoterT7Available SinceJuly 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT1AR
Plasmid#221820PurposePlasmid to express gRNA (gaccagtccactaccgcagc) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT1BR
Plasmid#221821PurposePlasmid to express gRNA1 (gaaaatttgatttcaactga) for editing at the end of Drosophila 5-HT1BR coding frameDepositorInsertd5-HT1BR gRNA1 (5-HT1B Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformD
Plasmid#221824PurposePlasmid to express gRNA2 (ctgaagacataattacgtgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformBFH
Plasmid#221825PurposePlasmid to express gRNA1 (cgctatcggtctgtgacaga) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT7R
Plasmid#221829PurposePlasmid to express gRNA (ggcgagggagagctttctct) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLL5.0_shRNAHsCavin1_Del4UC1_EGFP
Plasmid#229691PurposeLentiviral expression of shRNA targeting Cavin1 + reconstitution of zebrafish mutant Cavin1 (Del4UC1)DepositorUseLentiviralTagsEGFPMutationDel4UC1PromoterLTR viral promoterAvailable SinceJan. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLL5.0_shRNAHsCavin1_DrCavin1b_EGFP
Plasmid#229690PurposeLentiviral expression of shRNA targeting Cavin1 + reconstitution of zebrafish Cavin1 (Cavin1 rescue)DepositorUseLentiviralTagsEGFPPromoterLTR viral promoterAvailable SinceJan. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCS2-MfnG-EcYRS-EGFP*
Plasmid#191119PurposeA plasmid for incorporation of O-Me-Tyr into an EGFP reporter without O-Me-Tyr feeding for zebrafishDepositorInsertMfnG - P2A - Mutant E. coli TyrRS - T2A - enhanced green fluorescence protein
TagsHis tagExpressionMammalianAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only