We narrowed to 11,210 results for: nar
-
Plasmid#87401PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YOLCd1b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
AcrVA1_AsLOV2-S103ΔELS
Plasmid#246049PurposeExpression of AcrVA1-AsLOV2 hybrid in mammalian cells; insertion before S103 with deletion of surrounding amino acids ELS; enables optogenetic control of MbCas12aDepositorInsertAcrVA1_AsLOV2-S103ΔELS
UseCRISPR and Synthetic BiologyExpressionMammalianMutationΔELSAvailable SinceDec. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
AcrVA1_cpGR2(GGS5)-S103ΔELS
Plasmid#246050PurposeExpression of AcrVA1-cpGR2 hybrid in mammalian cells; insertion before S103 with deletion of surrounding amino acids ELS; enables chemogenetic control of MbCas12aDepositorInsertAcrVA1_cpGR2-S103ΔELS
UseCRISPR and Synthetic BiologyExpressionMammalianMutationΔELSAvailable SinceDec. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
H1_sgRNA(GRIN2B)_SauCas9
Plasmid#246054PurposeExpression of a sgRNA targeting the GRIN2B locus and SauCas9 under the same pol-III H1 promoterDepositorInsertSauCas9 and sgRNA(GRIN2B)
UseCRISPR and Synthetic BiologyExpressionMammalianAvailable SinceDec. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV_AcrIIC3_cpGR2(GGS5)-F59
Plasmid#246053PurposeExpression of AcrIIC3-cpGR2 hybrid in mammalian cells; insertion before F59; enables chemogenetic control of NmeCas9DepositorInsertAcrIIC3_cpGR2-F59
UseCRISPR and Synthetic BiologyExpressionMammalianAvailable SinceDec. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV_AcrIIA4_cpGR2(GGS5)-ΔN64_Q65_E66
Plasmid#246052PurposeExpression of AcrIIA4-cpGR2 hybrid in mammalian cells after Bubeck et al Nat Methods 2018; enables chemogenetic control of SpyCas9DepositorInsertAcrIIA4_cpGR2-ΔN64/Q65/E66
UseCRISPR and Synthetic BiologyExpressionMammalianMutationΔN64/Q65/E66Available SinceDec. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV_AcrIIA5_cpGR2(GGS5)-N77
Plasmid#246046PurposeExpression of AcrIIA5-cpGR2 hybrid in mammalian cells; insertion before N77; enables chemogenetic control of SauCas9DepositorInsertAcrIIA5_cpGR2-N77
UseCRISPR and Synthetic BiologyExpressionMammalianAvailable SinceDec. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV_AcrIIA5_cpGR2(GGS5)-D41
Plasmid#246045PurposeExpression of AcrIIA5-cpGR2 hybrid in mammalian cells; insertion before D41; enables chemogenetic control of SauCas9DepositorInsertAcrIIA5_cpGR2-D41
UseCRISPR and Synthetic BiologyExpressionMammalianAvailable SinceDec. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV_AcrIIA5_AsLOV2-N77
Plasmid#246044PurposeExpression of AcrIIA5-AsLOV2 hybrid in mammalian cells; insertion before N77; enables optogenetic control of SauCas9DepositorInsertAcrIIA5_AsLOV2-N77
UseCRISPR and Synthetic BiologyExpressionMammalianAvailable SinceDec. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV_AcrIIA5_AsLOV2-D41
Plasmid#246043PurposeExpression of AcrIIA5-AsLOV2 hybrid in mammalian cells; insertion before D41; enables optogenetic control of SauCas9DepositorInsertAcrIIA5_AsLOV2-D41
UseCRISPR and Synthetic BiologyExpressionMammalianAvailable SinceDec. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDNA-4TO-PHF13W255A
Plasmid#246124PurposeExpression of human PHF13 (W255A) with N terminal tet operator in mammalian cellsDepositorAvailable SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDNA-4TO-PHF13M246A
Plasmid#246123PurposeExpression of human PHF13 (M246A) with N terminal tet operator in mammalian cellsDepositorAvailable SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDNA-4TO-PHF13
Plasmid#246118PurposeExpression of human PHF13 with N terminal tet operator in mammalian cellsDepositorInsertPHF13 (PHF13 Human)
ExpressionMammalianAvailable SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pECFP-C1-PHF13 (100-200)
Plasmid#246112PurposeExpression of human PHF13 (100-200) fused to ECFP in mammalian cellsDepositorAvailable SinceNov. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pECFP-C1-PHF13 (150-300)
Plasmid#246111PurposeExpression of human PHF13 (150-300) fused to ECFP in mammalian cellsDepositorAvailable SinceNov. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pECFP-C1-PHF13 (1-150)
Plasmid#246110PurposeExpression of human PHF13 (1-150) fused to ECFP in mammalian cellsDepositorAvailable SinceNov. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pECFP-C1-PHF13
Plasmid#246107PurposeExpression of human PHF13 fused to ECFP in mammalian cellsDepositorAvailable SinceNov. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
PEYFP-C1-PHF13∆PEST2
Plasmid#246104PurposeExpression of human PHF13 with PEST2 deletion fused to mEYFP in mammalian cellsDepositorInsertPHF13∆PEST2 (PHF13 Human)
TagsmEYFPExpressionMammalianMutationdel PEST2 ( del aa 141 - 189 )Available SinceNov. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
PEYFP-C1-PHF13∆PEST1
Plasmid#246103PurposeExpression of human PHF13 with PEST1 deletion fused to mEYFP in mammalian cellsDepositorInsertPHF13∆PEST1 (PHF13 Human)
TagsmEYFPExpressionMammalianMutationdel PEST1 ( del aa 52 - 87 )Available SinceNov. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEYFP-C1-PHF13 (150-300)
Plasmid#246102PurposeExpression of human PHF13 (150-300) fused to mEYFP in mammalian cellsDepositorAvailable SinceNov. 12, 2025AvailabilityAcademic Institutions and Nonprofits only