We narrowed to 5,817 results for: 129
-
Plasmid#242179PurposeExpress doxycycline inducible 5 kb UCE-containing CRNDE in mammalian cellsDepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only
-
mCh-CRY2-sspB2
Plasmid#223691PurposePhoBIT2 component; sspB2 (sspB mutant A56F) fused to mCh-CRY2PHRDepositorAvailable SinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5h
Plasmid#160295PurposeYeast CRISPR plasmid targeting the hphMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5n
Plasmid#160296PurposeYeast CRISPR plasmid targeting the natMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5k
Plasmid#160294PurposeYeast CRISPR plasmid targeting the kanMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1nh
Plasmid#160299PurposeYeast CRISPR plasmid targeting the natMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kn
Plasmid#160298PurposeYeast CRISPR plasmid targeting the kanMX and natMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3puro-mGFP-FXR1-N2 (1-399)
Plasmid#225452PurposeExpress mEGFP-fusion protein of FXR1 fragment (1-399)DepositorAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3puro-mGFP-FXR1-N1 (1-379)
Plasmid#225450PurposeExpress mEGFP-fusion protein of FXR1 fragment (1-379)DepositorAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
gRNA giantin/GOLGB1
Plasmid#222315PurposeCRISPR/Cas9 close to the ATG of giantin/GOLGB1 gene.DepositorInsertgRNA targeting GOLB1 (GOLGB1 Human)
UseCRISPRAvailable SinceFeb. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRII-dgat2 in situ probe
Plasmid#232134Purposezebrafish dgat2 anti-sense in situ probe, linearize with BamHI, T7 polymeraseDepositorAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
MZB222
Plasmid#221772PurposeBacterial expression of 10xHis-SUMO (Smt3) fusion to Sec7 domain (687-885) of Big1 (ArfGEF1) for rapid nucleotide exchange and activation of Arf GTPasesDepositorAvailable SinceJan. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3puro-mGFP-FXR1a-CC1mut (N202P)
Plasmid#225455PurposeExpress mEGFP-fusion protein of FXR1 isoform a (N202P)DepositorAvailable SinceJan. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3puro-mGFP-FXR1a-Ccswap
Plasmid#225460PurposeExpress EGFP-fusion protein of FXR1 isoform a (CCswap)DepositorInsertFXR1 isoform a (FXR1 Human)
TagsEGFPExpressionMammalianMutationCCswap (swapped positions of CC2 and CC1)PromoterCMVAvailable SinceOct. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3puro-mGFP-FXR1a-CC1-CC1
Plasmid#225458PurposeExpress EGFP-fusion protein of FXR1 isoform a (CC1-CC1)DepositorInsertFXR1 isoform a (FXR1 Human)
TagsEGFPExpressionMammalianMutationCC2 replaced with a second copy of CC1PromoterCMVAvailable SinceOct. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3puro-mGFP-FXR1-N1-KH1mut (T236D H237D)
Plasmid#225453PurposeExpress mEGFP-fusion protein of FXR1 isoform a (T236D H237D)DepositorInsertFXR1 isoform a (FXR1 Human)
TagsmEGFPExpressionMammalianMutationT236D H237DPromoterCMVAvailable SinceOct. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pU6-tevopreq1-FXR1-G266E
Plasmid#225482PurposeExpress epegRNA for FXR1DepositorAvailable SinceOct. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3puro-mGFP-FXR1a-CC2mut (V361P)
Plasmid#225456PurposeExpress mEGFP-fusion protein of FXR1 isoform a (V361P)DepositorAvailable SinceOct. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3puro-mGFP-FXR1a-CC2-CC2
Plasmid#225459PurposeExpress mEGFP-fusion protein of FXR1 isoform a (CC2-CC2)DepositorInsertFXR1 isoform a (FXR1 Human)
TagsmEGFPExpressionMammalianMutationCC1 replaced with a second copy of CC2PromoterCMVAvailable SinceOct. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
LsgRNA-FXR1-KH1-gRNA
Plasmid#225483PurposeExpress gRNA for FXR1DepositorAvailable SinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only