We narrowed to 8,199 results for: Gal
-
Plasmid#232001PurposeBicistronic expression of CHMP2B Q165X mutant along with an mTagBFP2 transfection marker, connected via 2A sequences.DepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pCMV CHMP2B-L4D F5D-3XHA
Plasmid#232003PurposeExpression of a CHMP2B membrane binding mutant (L4D F5D) with a 3xHA tag.DepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEF1a FLAG-CHMP2B-d55-96
Plasmid#232013PurposeExpression of FLAG-tagged CHMP2B with the second alpha helix deleted.DepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSPcas9(BB)-2A-Puro V2.0 sgCHMP2B-2 aauucccaaaugaagauggc
Plasmid#231998PurposeExpression of an sgRNA targeting CHMP2B, Cas9, and a PuroR markerDepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458_mCherry-HP1a-gRNA-2
Plasmid#237635PurposeCas9 from S. pyogenes with 2A-mCherry, gRNA to knock-in msfGFP to HP1a locusDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRK5_mEGFP-SS18-SSX1-KS
Plasmid#237679PurposeFor overexpression of mEGFP-SS18-SSX1-KSDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRK5_mEGFP-SS18-SSX1
Plasmid#237678PurposeFor overexpression of mEGFP-SS18-SSX1DepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRK5_mEGFP-SS18-SSX2-KS
Plasmid#237680PurposeFor overexpression of mEGFP-SS18-SSX2-KSDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458_mCherry-HP1a-gRNA-1
Plasmid#237634PurposeCas9 from S. pyogenes with 2A-mCherry, gRNA to knock-in msfGFP to HP1a locusDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458_mCherry-TCOF1-gRNA
Plasmid#237633PurposeCas9 from S. pyogenes with 2A-mCherry, gRNA to knock-in msfGFP to TCOF1 locusDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUC19_msfGFP-FUS-repair-tempate
Plasmid#237684PurposeFor knock-in msfGFP to FUS locusDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRetro-CAG-DsRedExpress-TVA
Plasmid#235699PurposeControl plasmid expressing TVA and DsRed without G proteinDepositorInsertDsRedExpress, TVA800
UseRetroviralTagsExpressionMutationPromoterCAGAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
BD-pGEX5X3-BD-SARS-CoV-2-S-tail-Thr1273Glu
Plasmid#218458PurposeBacterial expression plasmid for the SARS-CoV-2 cytosolic tail (Thr1273Glu substitution) with an N-terminal GST tagDepositorInsertCytosolic tail of SARS-CoV-2 spike carrying Thr1273Glu substitution and an N-terminal GST-tag (S SARS-CoV-2)
UseTagsGSTExpressionBacterialMutationThr1273Glu substitutionPromoterAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
BD-pGEX5X3-BD-SARS-CoV-2-S-tail-His1271Lys
Plasmid#218456PurposeBacterial expression plasmid for the SARS-CoV-2 cytosolic tail (His1271Lys substitution) with an N-terminal GST tagDepositorInsertCytosolic tail of SARS-CoV-2 spike carrying His1271Lys substitution and an N-terminal GST-tag (S SARS-CoV-2)
UseTagsGSTExpressionBacterialMutationHis1271Lys substitutionPromoterAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
BD-pGEX5X3-SARS-CoV-2-S-tail-Lys1269Ala-His1271Ala
Plasmid#218459PurposeBacterial expression plasmid for the SARS-CoV-2 cytosolic tail (Lys1269Ala and His1271Ala substitutions) with an N-terminal GST tagDepositorInsertCytosolic tail of SARS-CoV-2 spike carrying Lys1269 and His1271 substitutions and an N-terminal GST-tag (S SARS-CoV-2)
UseTagsGSTExpressionBacterialMutationLys1269Ala and His1271Ala substitutionsPromoterAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEMS2389
Plasmid#225634PurposeAAV plasmid with Ple391 (DRD2 MiniPromoter) driving expression of EmGFP. Contains WPRE.DepositorAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEMS2383
Plasmid#225635PurposeAAV plasmid with Ple385 (GPR6 MiniPromoter) driving expression of EmGFP. Contains WPRE.DepositorAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEMS2387
Plasmid#225633PurposeAAV plasmid with Ple389 (ADORA2A MiniPromoter) driving expression of EmGFP. Contains WPRE.DepositorAvailable SinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
JO-pH720-SARS-CoV-2-S-tail-Cys1254Ala-Thr1273Glu
Plasmid#218454PurposeBacterial expression plasmid for the cytosolic tail of SARS-CoV-2 spike (with Cys1254Ala and Thr1273Glu substitutions) and an N-terminal eXact tagDepositorInsertCytosolic tail of SARS-CoV-2 spike carrying an N-terminal eXact tag and Cys1254Ala and Thr1273Glu substitutions (S SARS-CoV-2)
UseTagseXactExpressionBacterialMutationPromoterAvailable SinceJune 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
BD-pGEX5X3-BD-SARS-CoV-2-S-tail-Thr1273Asp
Plasmid#218457PurposeBacterial expression plasmid for the SARS-CoV-2 cytosolic tail (Thr1273Asp substitution) with an N-terminal GST tagDepositorInsertCytosolic tail of SARS-CoV-2 spike carrying Thr1273Asp substitution and an N-terminal GST-tag (S SARS-CoV-2)
UseTagsGSTExpressionBacterialMutationThr1273Asp substitutionPromoterAvailable SinceJune 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-3xFLAG-TAF5-∆ex8
Plasmid#209050PurposeVector for generating Flp-In cell lines allowing dox-inducible mammalian expression of 3xFlag-tagged TAF5 isoform lacking the alternative exon-8 (∆ex8)DepositorInsertTAF5 deltaexon-8
UseTagsFLAGExpressionMammalianMutationPromoterCMV/TO inducible promoterAvailable SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-miniTurbo-TAF5-∆ex8
Plasmid#209052PurposeVector for generating Flp-In cell lines allowing dox-inducible mammalian expression of miniTurbo fused to TAF5 isoform lacking the alternative exon-8 (∆ex8)DepositorInsertTAF5 deltaexon-8
UseTagsminiTurboExpressionMammalianMutationPromoterCMV/TO inducible promoterAvailable SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-3xFLAG-TAF5-FL_WobbleMut
Plasmid#209055PurposeVector for generating Flp-In cell lines allowing dox-inducible mammalian expression of 3xFlag-tagged full length TAF5 isoform mutated to be resistant to TAF5 siRNADepositorInsertTAF5 full length
UseTagsFLAGExpressionMammalianMutationPromoterCMV/TO inducible promoterAvailable SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-3xFLAG-TAF5-∆ex8_WobbleMut
Plasmid#209056PurposeVector for generating Flp-In cell lines allowing dox-inducible mammalian expression of 3xFlag-tagged TAF5 isoform lacking the alternative exon-8 (∆ex8) mutated to be resistant to TAF5 siRNADepositorInsertTAF5 deltaexon-8
UseTagsFLAGExpressionMammalianMutationPromoterCMV/TO inducible promoterAvailable SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mClover-intergenic-As
Plasmid#209036PurposeLentiviral vector expressing mClover3 along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-nSpCas9-TadA8.20m
Plasmid#209045PurposeLentiviral vector expressing doxycycline-inducible human codon-optimized adenine base editor where TadA8.20m is fused to the N-terminus of SpCas9(D10A)-6xNLSDepositorInsertTadA8.20m-nSpCas9
UseCRISPR and LentiviralTagsFLAG-HAExpressionMammalianMutationD10APromoterTight TRE promoterAvailable SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mClover-intergenic_2-As
Plasmid#218814PurposeLentiviral vector expressing mClover3 along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mClover-intergenic_3-As
Plasmid#218815PurposeLentiviral vector expressing mClover3 along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mClover-intergenic_4-As
Plasmid#218816PurposeLentiviral vector expressing mClover3 along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL3-pSMANTIS_1kb_KLF2mut 732
Plasmid#194195PurposeIncludes the promoter (1kb) of SMTS with mutated KLF binding sites (position 732)DepositorInsertSMANTIS promoter (1kb) (SMANTIS Human)
UseLuciferaseTagsExpressionMutationmutated KLF binding sites (position 732)PromoterSMANTIS promoter (1kb), mutatedAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL3-pSMANTIS_1kb_KLF2mut 884
Plasmid#194196PurposeIncludes the promoter (1kb) of SMTS with mutated KLF binding sites (position 884)DepositorInsertSMANTIS promoter (1kb) (SMANTIS Human)
UseLuciferaseTagsExpressionMutationmutated KLF binding sites (position 884)PromoterSMANTIS promoter (1kb), mutatedAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL3-pSMANTIS_1kb_KLF2mut 449
Plasmid#194197PurposeIncludes the promoter (1kb) of SMTS with mutated KLF binding sites (position 449)DepositorInsertSMANTIS promoter (1kb) (SMANTIS Human)
UseLuciferaseTagsExpressionMutationmutated KLF binding sites (position 449)PromoterSMANTIS promoter (1kb), mutatedAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL3-pSMANTIS_1kb_KLF2mut 449,548,732,899 (Quin)
Plasmid#194191PurposeIncludes the promoter (1kb) of SMTS with 4 mutated KLF binding sites (positions 449,548,732,899)DepositorInsertSMANTIS promoter (1kb) (SMANTIS Human)
UseLuciferaseTagsExpressionMutation4 mutated KLF binding sites (positions 449,548,73…PromoterSMANTIS promoter (1kb), mutatedAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL3-pSMANTIS_1kb_KLF2mut 449,548,732 (Tri)
Plasmid#194192PurposeIncludes the promoter (1kb) of SMTS with 3 mutated KLF binding sites (positions 449,548,732)DepositorInsertSMANTIS promoter (1kb) (SMANTIS Human)
UseLuciferaseTagsExpressionMutation3 mutated KLF binding sites (positions 449,548,73…PromoterSMANTIS promoter (1kb), mutatedAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL3-pSMANTIS_1kb_KLF2mut 548
Plasmid#194194PurposeIncludes the promoter (1kb) of SMTS with mutated KLF binding sites (position 548)DepositorInsertSMANTIS promoter (1kb) (SMANTIS Human)
UseLuciferaseTagsExpressionMutationmutated KLF binding sites (position 548)PromoterSMANTIS promoter (1kb), mutatedAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCSmEn2n4ERT(#234)
Plasmid#184082Purposecyclofen-inducible chicken EN2 (mut) activation via mammalian cell transfection or mRNA synthesisDepositorInsert6his-myc-chkEn2(n4)-ERT2
UseSynthetic BiologyTags6his-MycExpressionMammalianMutationchkEn2: G238S; ERT2: G400V, M543A, L544A, deleted…PromotersCMV+SP6Available SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCSmEn2SRERT(#231)
Plasmid#184080Purposecyclofen-inducible chicken EN2 (mut) activation via mammalian cell transfection or mRNA synthesisDepositorInsert6his-myc-chkEn2(SR)-ERT2
UseSynthetic BiologyTags6his-MycExpressionMammalianMutationchkEn2: W247S, F248R; ERT2: G400V, M543A, L544A, …PromotersCMV+SP6Available SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT22gCfpUbm5En2E4PCh(#251)
Plasmid#184083Purposecyclofen-inducible chicken EN2 (wt) activation in zebrafish permanent transgenicDepositorInsert5myc-chkEn2-ERT2-P2A-mCherry
UseZebrafish transgenesis (blue eyes)Tags5xMycExpressionMutationERT2: G400V, M543A, L544A, deleted 1-281;PromoterZf-UbiAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT22UbHEn2E4PCh(#262)
Plasmid#184084Purposecyclofen-inducible chicken EN2 (wt) activation in zebrafish permanent transgenicDepositorInsert3HA-chkEn2-ERT2-P2A-mCherry
UseZebrafish transgenesis (blue eyes)Tags3xHAExpressionMutationERT2: G400V, M543A, L544A, deleted 1-281;PromoterZf-UbiAvailable SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCSmEn25EERT(#232)
Plasmid#184081Purposecyclofen-inducible chicken EN2 (mut) activation via mammalian cell transfection or mRNA synthesisDepositorInsert6his-myc-chkEn2(5E)-ERT2
UseSynthetic BiologyTags6his-MycExpressionMammalianMutationchkEn2: S150E, S151E, S153E, S155E, S156E; ERT2: …PromotersCMV+SP6Available SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only