We narrowed to 3,458 results for: cgas
-
Plasmid#87116PurposeAAV backbone plasmid including GFP knock-in donor and Tubb3gRNA for HITIDepositorInsertU6-mTubb3sgRNA-GFP-EF1a-mCherryKASH-hGHpA
UseAAV and CRISPRAvailable SinceMarch 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
px330-Axin1
Plasmid#162543PurposesgRNA targeting Axin1DepositorAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(SMARCA4(15))-PGKpuro2ABFP-W
Plasmid#200462PurposeLentiviral vector expressing gRNA targeting human SMARCA4DepositorInsertSMARCA4(15) (SMARCA4 Human)
UseLentiviralAvailable SinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
Icam 2 SaCas9 YAP sgRNA2
Plasmid#99735PurposeExpresses SaCas9 and a gRNA targeting mouse YAPDepositorAvailable SinceDec. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-PRKCG
Plasmid#23640DepositorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
ATM gRNA (BRDN0001146099)
Plasmid#77530Purpose3rd generation lentiviral gRNA plasmid targeting human ATMDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pXPR003-sgTP53-4
Plasmid#118022PurposeConstitutive expression of sgRNA targeting human TP53DepositorAvailable SinceOct. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(JARID2_5-4)-PGKpuroBFP-W
Plasmid#211966PurposeExpress gRNA against JARID2 with puro and BFPDepositorInsertsgRNA targeting JARID2 (JARID2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
MAGI1 gRNA (BRDN0001146934)
Plasmid#78069Purpose3rd generation lentiviral gRNA plasmid targeting human MAGI1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR-53BP1 1-1972 28A
Plasmid#53447PurposeRecombinational donor/master vectorDepositorInsert53BP1 (TP53BP1 Human)
UseGatewayMutationI914T mutation; All 28 SQ/TQ motifs in N-term of …Available SinceDec. 10, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
pKLV2-U6gRNA5(hYAP1-Y2B)-PGKpuro2AmCherry-W
Plasmid#163179PurposeLentiviral gRNA plasmid targeting human YAP1 gene, co-expression of mCherry tagDepositorAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-FCGRT-Fc(DAPA)-AviTag-6xHis
Plasmid#156820PurposeMammalian expression of cell-surface protein extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertFCGRT (FCGRT Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GFAP-eGFP-shAqp4-3
Plasmid#223224Purposemir30 based shRNA strategy, shRNA targeting mouse Aqp4DepositorInsertshAqp4 (Aqp4 Mouse)
UseAAVAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-FCGRT-COMP5AP-AviTag-9xHis
Plasmid#157384PurposeMammalian expression of cell-surface protein extracellular domain fused to COMP5AP-AviTag-9xHis. Protein is secreted from cells.DepositorAvailable SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hWWTR1-W1K)-PGKpuro2AmCherry-W
Plasmid#163176PurposeLentiviral gRNA plasmid targeting human WWTR1 gene, co-expression of mCherry tagDepositorAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pU6-pegRNA-HEK3-CTTins-px330-scaffold
Plasmid#180017PurposeTransiently expressing a pegRNA to introduce HEK3 CTT insertion in human cells. It has a sgRNA scaffold from px330.DepositorInsertPrime editing pegRNA for HEK3-CTTins, with px330 scaffold (EPHA8 Synthetic)
UseCRISPRExpressionMammalianPromoterHuman U6Available SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-FCGR3B-Fc(DAPA)-AviTag-6xHis
Plasmid#156579PurposeMammalian expression of cell-surface protein extracellular domain fused to Fc(DAPA)-Avi-6xHis. Protein is secreted from cells.DepositorInsertFCGR3B (FCGR2B Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
px458-CCND1
Plasmid#172630PurposeExpresses a gRNA against CCND1 and Cas9 from S. pyogenes with 2A-EGFPDepositorAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT2-shATRX
Plasmid#124258PurposeExpresses shRNA targeting ATRX. Construct has inverted repeats to be used in Sleeping beauty system.DepositorInsertshATRX
ExpressionMammalianAvailable SinceApril 8, 2019AvailabilityAcademic Institutions and Nonprofits only