We narrowed to 5,092 results for: NOG;
-
-
-
-
KHBD00481
Plasmid#39589DepositorAvailable SinceSept. 18, 2012AvailabilityAcademic Institutions and Nonprofits only -
KHBD00744
Plasmid#39751DepositorAvailable SinceAug. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
KHBD00629
Plasmid#39699DepositorAvailable SinceAug. 28, 2012AvailabilityAcademic Institutions and Nonprofits only -
-
-
KHBD00751
Plasmid#39757DepositorAvailable SinceAug. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
LB1360 (Bcl-2 promoter with MHS4)
Plasmid#15392DepositorInsertB-cell lymphoma/leukemia-2 (BCL2 Human)
UseLuciferaseTagsLuciferaseExpressionBacterial and MammalianMutationBcl-2 full promoter with IgH enhancers MHS4Available SinceAug. 1, 2007AvailabilityAcademic Institutions and Nonprofits only -
Stat92e pBluescript SK(+)
Plasmid#8712DepositorInsertStat92e (Stat92E Fly)
ExpressionBacterialAvailable SinceJuly 8, 2005AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-d5-HT2BR
Plasmid#221828PurposePlasmid to express gRNA2 (aggcactcgtgctcgaatag) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-for-dSERT
Plasmid#221830PurposePlasmid to express gRNA1 (cgaaatctgcgctctacttg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-for-dSERT
Plasmid#221831PurposePlasmid to express gRNA2 (gggattcgagcggcccgtcg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT2BR
Plasmid#221827PurposePlasmid to express gRNA1 (ttcagtttgcccggtttaac) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pACUH 5-HT7R-7xGFP11-HA
Plasmid#221836PurposePlasmid for generating 10xUAS-5-HT7R-7xGFP11-HA transgenic flies with attP/attB integration. It carries the attB sequence.DepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR_CG6867_nostop
Plasmid#240238PurposeGateway entry clone with CG6867 without stop codonDepositorInsertCG6867 (CG6867 Fly)
UseGateway shuttle vectorAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRSF-G1(7CNW)RS
Plasmid#222874PurposetRNA synthetase/tRNA pair for the in vivo incorporation of 7-Cyano-L-Tryptophan (7-CN-Trp) into proteins in E. coli in response to the amber (TAG) codonDepositorInserttRNA synthetase
ExpressionBacterialPromoterT7Available SinceFeb. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
TadA-8e-eIscBn
Plasmid#227018PurposeVector encoding human codon-optimized enhanced-activity nOgeuIscB fusion with TadA8e driven by CMV promoterDepositorInsertbpNLS-TadA-8e-linker-nOgeuIscB-v3-bpNLS
MutationD96R/E84R/V159R/H339APromoterCMVAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCHC024 (∆SH)
Plasmid#226202PurposeElectroporation knockout plasmid (pK18sB) to delete the C. necator soluble hydrogenase operon (deltaSH).DepositorInsertHomology arms for soluble hydrogenase operon
UseSynthetic BiologyMutation∆hoxFUYHWI ∆hypA2B2F2Available SinceNov. 18, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits
