We narrowed to 2,240 results for: ARP
-
Plasmid#199682PurposeTransient expression of LYCHOS (GPR155) ∆LED-HADepositorInsertGPR155 (GPR155 Human)
TagsHAExpressionMammalianMutationDeletion from amino acid 556-651PromoterCMVAvailable SinceMay 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5-LYCHOS (GPR155) FP>IA-HA
Plasmid#199661PurposeTransient expression of LYCHOS (GPR155) FP>IA mutantDepositorInsertGPR155 (GPR155 Human)
TagsHAExpressionMammalianMutationF43 and P44 mutated to I and APromoterCMVAvailable SinceApril 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α1.1-Chronos-GFP
Plasmid#122098PurposeAAV-mediated expression of Chronos-GFP under the EF1α promoter (1.1kb short version). Using SV40 pA signal.DepositorInsertChronos-GFP
UseAAVTagsGFPExpressionMammalianPromoterEF1α (1.1 kb short version)Available SinceAug. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pVD1 Multiplexing Edit En-1 (GB2242)
Plasmid#160564PurposetRNA and scaffold for the assembly of GBoligomers for the position [5_(n-1)] of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoter.DepositorInsertMultiplexing Edit (En-1)
UseCRISPR and Synthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
FLAG-VAPA
Plasmid#255771PurposeHuman VAPA with FLAGDepositorAvailable SinceMay 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCMV sfGFP-CHMP6 57-98
Plasmid#242420PurposeExpression of the second alpha helix of CHMP6 (residues 57-98), N-terminally tagged with sfGFPDepositorInsertCHMP6 (CHMP6 Human)
TagssfGFP (superfolder GFP)ExpressionMammalianMutationResidues 57-98PromoterCMVAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSPcas9(BB)-2A-Puro V2.0 sgCHMP2B-2 aauucccaaaugaagauggc
Plasmid#231998PurposeExpression of an sgRNA targeting CHMP2B, Cas9, and a PuroR markerDepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
TFORF3379
Plasmid#144855PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFB-CG-LYCHOS WT-HA-GFP
Plasmid#199687PurposeExpression of LYCHOS WT in insect cellsDepositorAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5-LYCHOS (GPR155) ∆DEP-HA
Plasmid#199683PurposeTransient expression of LYCHOS (GPR155) ∆DEP-HADepositorAvailable SinceMay 23, 2023AvailabilityAcademic Institutions and Nonprofits only