We narrowed to 7,801 results for: aav
-
Plasmid#223144PurposeExpression of truncated MBD1 with dCjCas9 and empty gRNA scaffoldDepositorInsertMBD1 (MBD1 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 529-592PromoterEF1aAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1306-AAV-EFSNC-dSaCas9-HP1aNH(115-177)
Plasmid#223151PurposeExpression of truncated HP1a with dSaCas9 and empty gRNA scaffoldDepositorInsertHP1a (CBX5 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 115-177PromoterEF1aAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1296-AAV-EFSNC-dCjCas9-HP1aNH(115-177)
Plasmid#223141PurposeExpression of truncated HP1a with dCjCas9 and empty gRNA scaffoldDepositorInsertHP1a (CBX5 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 115-177PromoterEF1aAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1309-AAV-EFSNC-dSaCas9-MBD1(529-592)
Plasmid#223154PurposeExpression of truncated MBD1 with dSaCas9 and empty gRNA scaffoldDepositorInsertMBD1 (MBD1 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 529-592PromoterEF1aAvailable SinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1308-AAV-EFSNC-dSaCas9-HP1bNH(111-173)
Plasmid#223153PurposeExpression of truncated HP1b with dSaCas9 and empty gRNA scaffoldDepositorInsertHP1b (CBX1 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 111-173PromoterEF1aAvailable SinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1313-AAV-EFSNC-dSaCas9-MECP2(204-310)
Plasmid#223158PurposeExpression of truncated MECP2 with dSaCas9 and empty gRNA scaffoldDepositorInsertMECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310PromoterEF1aAvailable SinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1890 - pAAV-AiE2577m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214571PurposeAiE2577m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1311-AAV-EFSNC-dSaCas9-NIPP1(143-224)
Plasmid#223156PurposeExpression of truncated NIPP1 with dSaCas9 and empty gRNA scaffoldDepositorInsertNIPP1 (PPP1R8 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 143-224PromoterEF1aAvailable SinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1310-AAV-EFSNC-dSaCas9-MBD2(176-231)
Plasmid#223155PurposeExpression of truncated MBD2 with dSaCas9 and empty gRNA scaffoldDepositorInsertMBD2 (MBD2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 176-231PromoterEF1aAvailable SinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1930 - pAAV-AiE2357m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214584PurposeAiE2357m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceAug. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1412 - pAAV-AiE2183m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214490PurposeAiE2183m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1725 - pAAV-AiE2394m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214528PurposeAiE2394m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1762 - pAAV-AiE2344m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214538PurposeAiE2344m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1531 - pAAV-AiE2036m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214505PurposeAiE2036m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1426 - pAAV-AiE2133m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214496PurposeAiE2133m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1513 - pAAV-AiE2192m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214503PurposeAiE2192m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1668 - pAAV-AiE2347m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214513PurposeAiE2347m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1850 - pAAV-AiE2529m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214553PurposeAiE2529m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1432 - pAAV-AiE2144m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214498PurposeAiE2144m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1424 - pAAV-AiE2131m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214494PurposeAiE2131m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1882 - pAAV-AiE2464m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214568PurposeAiE2464m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1878 - pAAV-AiE2425m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214566PurposeAiE2425m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1690 - pAAV-AiE2365m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214517PurposeAiE2365m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1844 - pAAV-AiE2474m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214549PurposeAiE2474m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs
Plasmid#195018PurposeAn adeno-associated viral vector expressing eGFP-KASH and two guides targeting mouse TACR1DepositorInsertsCCGTATAGGCGGCTGCCCAA
EGFP-KASH
TTCCGTGGTGGGCAACGTAG
UseAAVTagsKASH domain of Nesprin2PromoterEF1a, hU6, and mU6Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1970 - pAAV-AiE2585m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214598PurposeAiE2585m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1895 - pAAV-AiE2583m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214574PurposeAiE2583m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1897 - pAAV-AiE2486m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214575PurposeAiE2486m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1916 - pAAV-AiE2437m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214577PurposeAiE2437m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP1920 - pAAV-AiE2375m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214580PurposeAiE2375m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only