We narrowed to 7,617 results for: Trac
-
Plasmid#136364PurposeExpresses epitope-tagged human TET3 WT in mammalian cellsDepositorAvailable SinceFeb. 14, 2020AvailabilityAcademic Institutions and Nonprofits only
-
pLKO-Tet-On-PLXNB2-shRNA1
Plasmid#98399PurposeLentivirus for expression of shRNA1 against human PLEXIN-B2 (Dox-inducible)DepositorInsertPlexin-B2 (PLXNB2 Human)
UseLentiviralAvailable SinceJuly 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFastBac-M13-6His-KIF1C-GFP
Plasmid#130975PurposeExpression of 6His-KIF1C-GFP in insect cells for protein purification.DepositorInsertKIF1C-GFP (KIF1C Human)
Tags6His and GFPExpressionInsectMutation5 silent mutations that make this construct RNAi …PromoterPolyhedrinAvailable SinceOct. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLIK CA MLCK
Plasmid#84647PurposeLentiviral expression of doxycycline-inducible constitutively active MLCK and co-expression of VenusDepositorAvailable SinceDec. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Beta1
Plasmid#140987PurposeEncodes a Gbeta subunit (GNB1) as an optimal component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGBeta1 (GNB1 Human)
ExpressionMammalianMutationContains an N-terminal human rhinovirus (HRV) 3C …PromoterCMVAvailable SinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
tetO-NR2F1
Plasmid#170698Purposedoxycycline-inducible overexpression of NR2F1DepositorInsertnuclear receptor subfamily 2 group F member 1 (NR2F1 Human)
UseLentiviral; Doxycycline inducibleExpressionMammalianMutationdeletion of 36G- please see depositor commentsPromoterTRE promoter, Tet-ONAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPBbsr2-AREG-ScNeo
Plasmid#209910PurposeTo monitor the status of Amphiregulin, the plasmid encodes a recombinant AREG fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBrain-ch-TOGKDP-GFP-shch-TOG
Plasmid#69113PurposeDual-promoter plasmid to express knockdown-proof human ch-TOG tagged with EGFP along with shRNA to knock down endogenous ch-TOG in mammalian cells.DepositorInsertsUseRNAiTagsEGFPExpressionMammalianMutationSilent mutations to confer shRNA resistance.PromoterCMVAvailable SinceOct. 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
AAV pCAG-FLEX2-tTA2-WPRE-bGHpA
Plasmid#65458PurposeCan be used to generate AAV virus that will express the tetracycline transactivator tTA2 from the CAG promoter in a Cre-dependent mannerDepositorInserttTA2
UseAAVPromoterCAGAvailable SinceJuly 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHLS-EF1a-FRB-SpCas9-A
Plasmid#138477PurposeExpresses FRB fused SpCas9 for NanoMEDIC packaging.DepositorInsertSpCas9, human codon optimized
UseCRISPRTags3x HA tag and FRBExpressionMammalianAvailable SinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO-GAlphaGustducin-RLuc8
Plasmid#140979PurposeEncodes a G alpha subunit (GNAT3) containing RLuc8 as an optimal component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGAlphaGustducin-RLuc8 (GNAT3 Human)
UseLuciferaseExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable SinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-MARCer-Blast
Plasmid#160550Purposelabeling hypoxic cellsDepositorAvailable SinceDec. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL G44S (siRNA resistant)
Plasmid#191012PurposeExpresses EGFP-tagged kinase-dead MASTL G44S with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationG44SAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
tetO-HAND2
Plasmid#170690Purposedoxycycline-inducible overexpression of HAND2DepositorInsertHAND2 (HAND2 Human)
UseLentiviral; Doxycycline inducibleExpressionMammalianPromoterTRE promoter, Tet-ONAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTRIP-hPGK-Blast-2A-STING-mNeonGreen
Plasmid#227186PurposeLentiviral expression plasmid encoding STING-mNeonGreen under hPGK promoterDepositorAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL E167D (siRNA resistant)
Plasmid#191013PurposeExpresses EGFP-tagged MASTL with E167D mutation and resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationE167DAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCSIIpuro-EREG-ScNeo
Plasmid#209896PurposeTo monitor the status of Epiregulin, the plasmid encodes a recombinant Epiregulin fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorInsertEREG-ScNeo (EREG Human)
UseLentiviralTagsGGGSGGGS linker, HA tag, mNeonGreen, and mScarlet…Available SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCSIIpuro-EPGN-ScNeo
Plasmid#209899PurposeTo monitor the status of Epigen, the plasmid encodes a recombinant Epigen fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
Epac-S-H327
Plasmid#228243PurposemT2Del_EPACdDEPCD_Q270E_M312L_L777A_K778A_tdBlackcp173Venus(ST) biosensor to measure realtime changes in FRET reflecting fluctuations in cAMP levels in living cells.DepositorInsertmT2Del_EPACdDEPCD_Q270E_M312L_L777A_K778A_tdBlackcp173Venus(ST) (RAPGEF3 Human)
ExpressionMammalianMutationDeletion of DEP domain, Catalytically dead T781A …PromoterCMVAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
Epac-S-H328
Plasmid#228244PurposemT2Del_EPACdDEPCD_Q270E_M312L_E325T_L777A_K778A_tdBlackcp173Venus(ST) biosensor to measure realtime changes in FRET reflecting fluctuations in cAMP levels in living cells.DepositorInsertmT2Del_EPACdDEPCD_Q270E_M312L_E325T_L777A_K778A_tdBlackcp173Venus(ST) (RAPGEF3 Human)
ExpressionMammalianMutationDeletion of DEP domain, Catalytically dead T781A …PromoterCMVAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only