We narrowed to 4,378 results for: crispr c plasmids
-
Plasmid#214032PurposeBacterial expression plasmid for strep-tagged SAVED-CHAT cA3-binding pocket mutant from Haliangium ochraceumDepositorInsertSAVED-CHAT
TagsStrep-tag IIExpressionBacterialMutationK121E, Q122A, N274A, R276E, Y285A, F286APromoterT7 promoterAvailable SinceJune 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJS-BCD-Strep-SAVED-CHAT-sm
Plasmid#214033PurposeBacterial expression plasmid for strep-tagged SAVED-CHAT CHAT-CHAT singlet interface mutant from Haliangium ochraceumDepositorInsertSAVED-CHAT
TagsStrep-tag IIExpressionBacterialMutationR456E, D459K, D476K, R479EPromoterT7 promoterAvailable SinceJune 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJS-BCD-Strep-dPCaspase
Plasmid#214035PurposeBacterial expression plasmid for strep-tagged catalytically dead PCaspase (Prokaryotic Caspase) from Haliangium ochraceumDepositorInsertPCaspase
TagsStrep-tag IIExpressionBacterialMutationH79A, C146APromoterT7 promoterAvailable SinceJune 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJS-BCD-Strep-PCaspase-R153A
Plasmid#214036PurposeBacterial expression plasmid for strep-tagged PCaspase (Prokaryotic Caspase) R153A mutant from Haliangium ochraceumDepositorInsertPCaspase
TagsStrep-tag IIExpressionBacterialMutationR153APromoterT7 promoterAvailable SinceJune 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-PMR1
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFTK086
Plasmid#171358PurposePart Plasmid Entry Vector (LVL0) from the Fungal Modular Cloning ToolKit.DepositorInsertP-ANtRNA[Arg21]-sgRNA-dummy-Esp3I, Pol-III sgRNA-plug-in transcription unit
UseSynthetic BiologyExpressionBacterial and YeastMutationn/aAvailable SinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFTK063
Plasmid#171335PurposePart Plasmid Entry Vector (LVL0) from the Fungal Modular Cloning ToolKit.DepositorInsertdSpCas9(m4) (for fusion)
UseSynthetic BiologyExpressionBacterial and YeastMutationn/aAvailable SinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFTK062
Plasmid#171334PurposePart Plasmid Entry Vector (LVL0) from the Fungal Modular Cloning ToolKit.DepositorInsertdSpCas9(m2) (for fusion)
UseSynthetic BiologyExpressionBacterial and YeastMutationn/aAvailable SinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFTK057
Plasmid#171329PurposePart Plasmid Entry Vector (LVL0) from the Fungal Modular Cloning ToolKit.DepositorInsertdSpCas9(m4)-VPR-NLS
UseSynthetic BiologyExpressionBacterial and YeastMutationn/aAvailable SinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMini-CMV-NLS-dead R-IscB_ADAR2dd-NES_T2A_mCherry (W98X)_U6-ωRNA
Plasmid#246432PurposeAll-in-one plasmid. Expresses R-IscB_ADAR2dd in mammalian cells for A-to-I RNA editing. Inactive mCherry included to assess A-to-I editing. Spacer included can direct mCherry fluorescence recovery.DepositorInsertsO.gue IscB with dead mutations (D60A, H269A) and delta-TID, fused to human ADAR2 deaminase domain (ADARB1 Human, human gut metagenome, Synthetic)
mCherry
ωRNA
TagsHIV NES, SGGSSGGSSGSETPGTSESATPESSGGSSGGS linker …ExpressionMammalianMutationR-IscB: changed Aspartic Acid 60 to Alanine, chan…PromoterCMV and U6Available SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pADH99Cau
Plasmid#244807PurposeModified plasmid from pADH99 to perform HIS-FLP CRISPR in Candidozyma aurisDepositorInsertCauHIS1_US
UseCRISPRTagsC. albicans MAL2 promoter, C. albicans codon opti…ExpressionYeastAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
hNTa2-qgRNA-pYJA5
Plasmid#217780PurposeNon-targeting control 2 qgRNA-pYJA5 plasmid from the T.gonfio library; it can be used as a ready-to-go control and provides the three constant regions for the three-fragment PCRs for qgRNA cloningDepositorInsertQuadruple sgRNA-expression cassette for nontargeting control for gene activation and epigenetic silencing
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterhuman U6, mouse U6, human H1, human 7SKAvailable SinceApril 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CR033
Plasmid#234042Purposeexpresses ABE8e(V106W) base editor in a human T cell optimized lentiviral transfer plasmidDepositorInsertTadA8e(V106W)-Cas9(D10A)-P2A-blast
UseLentiviralAvailable SinceApril 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Puro CAG eGFP NLS
Plasmid#170830PurposeDonor plasmid for knocking eGFP NLS into AAVS1 safe harbor locusDepositorInserteGFP
UseCRISPR, Synthetic Biology, and TALENTagsNLSExpressionMammalianPromoterCAGAvailable SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
PX458-3xHA-en31FnCas9ABEmax8.17d
Plasmid#201956PurposeMammalian expression plasmid of en31FnCas9ABEmax8.17d base editor with T2A-EGFP and cloning backbone for sgRNADepositorInsertbpNLS-en31FnCas9ABEmax8.17d-bpNLS-3xHA-T2A-EGFP
UseCRISPRTags3xHA, NLS, and T2A-EGFPExpressionMammalianPromoterCbhAvailable SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
PX458-3xHA-en15FnCas9
Plasmid#201948PurposeMammalian expression plasmid of enhanced activity FnCas9 variant en15FnCas9 with T2A-EGFP and cloning backbone for sgRNADepositorInsert3xHA-NLS-en15FnCas9-T2A-EGFP
UseCRISPRTags3xHA, NLS, and T2A-EGFPExpressionMammalianMutationE1603H on FnCas9PromoterCbhAvailable SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIG-671_HA-GD2-28z_CAR_tNGFR
Plasmid#207484PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInserttNGFR, HA-GD2-28z_CAR (NGFR Human)
UseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIG-727_HA-GD2-28z_CAR_RFP-tNGFR
Plasmid#207487PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInsertRFP-tNGFR, HA-GD2-28z_CAR (NGFR Human)
UseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIG-747_CD19-28z_CAR_TFAP4
Plasmid#207489PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInsertTFAP4, CD19-28z_CAR (TFAP4 Human)
UseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIG-804_HA-GD2-28z_CAR_BATF-TFAP4
Plasmid#207491PurposeThis plasmid can be used to generate HDR templates for non-viral knockin into the TRAC locus of human T cells.DepositorInsertBATF-TFAP4, HA-GD2-28z_CAR (BATF Human)
UseCRISPRAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only