We narrowed to 14,204 results for: RING;
-
Plasmid#240690PurposeRSF1010 origin of replication plasmid containing Eco1 recombitron with a SapI flanked stuffer in the ncRNA expressed by J23115 constitutive promoterDepositorInsertEco1 RT, Eco1 ncRNA, CspRecT and EcSSB
ExpressionBacterialMutationWTAvailable SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSmBit-CHIP-K30A
Plasmid#236066PurposeSmBit-CHIP expression with K30A substitutionDepositorAvailable SinceSept. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT2BR
Plasmid#221827PurposePlasmid to express gRNA1 (ttcagtttgcccggtttaac) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-d5-HT2BR
Plasmid#221828PurposePlasmid to express gRNA2 (aggcactcgtgctcgaatag) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-for-dSERT
Plasmid#221830PurposePlasmid to express gRNA1 (cgaaatctgcgctctacttg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-for-dSERT
Plasmid#221831PurposePlasmid to express gRNA2 (gggattcgagcggcccgtcg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pACUH 5-HT7R-7xGFP11-HA
Plasmid#221836PurposePlasmid for generating 10xUAS-5-HT7R-7xGFP11-HA transgenic flies with attP/attB integration. It carries the attB sequence.DepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCR197
Plasmid#240643PurposeExpression of the tri-cistronic construct NES-AmNeonGreen-P2A-mTurquoise2-NLS-T2A-mScarlet-I-PTS1 in Exaiptasia diaphana; In vitro transcription of the same construct via SP6 polymeraseDepositorInsertsAIPGENE865 promoter
SP6 promoter
AmNeonGreen
mTurquoise2
mScarlet-I
UseGene expression and genomic integration in fishTagsNES (from Exaiptasia diaphana MEK2), NLS (from SV…MutationCodon-optimized for Exaiptasia diaphana, amino ac…Available SinceAug. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pREC1010-opEbu1
Plasmid#240702PurposeRSF1010 origin of replication plasmid containing Ebu1 recombitron with extended a1 a2 regions with a donor in the ncRNA targeting lacZ locus in Citrobacter freundii ATCC 8090 expressed by Pm promoterDepositorInsertEbu1 RT, Ebu1 ncRNA, CspRecT and EcSSB
ExpressionBacterialMutationExtended a1 a2 regionsAvailable SinceAug. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pREC1010-Abe1
Plasmid#240683PurposeRSF1010 origin of replication plasmid containing Abe1 recombitron with a SapI flanked stuffer in the ncRNA expressed by Pm promoterDepositorInsertAbe1 RT, Abe1 ncRNA, CspRecT and EcSSB
ExpressionBacterialMutationWTAvailable SinceAug. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
mCh-CRY2-sspB2
Plasmid#223691PurposePhoBIT2 component; sspB2 (sspB mutant A56F) fused to mCh-CRY2PHRDepositorAvailable SinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-HA-Sema7A
Plasmid#190644PurposeExpresses Mouse Sema7A with HA TagDepositorAvailable SinceJuly 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-miR30-shJAG1 #4
Plasmid#171197PurposeRetroviral vector for U6 promoter driven expression empty miR30 based shJAG1 #4 (to be used in conjunction with Phoenix packaging cells).DepositorInsertshJAG1 #4
UseRetroviralExpressionMammalianPromoterU6Available SinceMay 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMDC32B-B/c
Plasmid#227963PurposeExpression plasmid with a ccdB cassette flanked with two inverted BsaI restriction sites. Allows the high throughput cloning of cloning inserts flanked with compatible 4-nt overhangs.DepositorInsertB/c
ExpressionPlantPromoter35SAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFNC-2
Plasmid#227667PurposePlasmid encoding the BxbI phage integrase. It can be used to remove the antibiotic resistance cassette integrated with pCIFR. KmR, easily curable via sucrose counterselection.DepositorInsertKmR
ExpressionBacterialAvailable SinceApril 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCIFR-5
Plasmid#233294PurposeIntegration of msfGFP (or your Module Of Interest) in a random fashion via Tn5 insertion. The antibiotic cassette used for selecting for the integration can be removed in a later stage with pFNC.DepositorInsertmsfGFP
Promoterp14G-BCD2Available SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFNC-5
Plasmid#233297PurposePlasmid encoding the BxbI phage integrase. It can be used to remove the antibiotic resistance cassette integrated with pCIFR. TcR, easily curable via sucrose counterselection.DepositorInsertsBxbI phage integrase
sacB
ExpressionBacterialPromoterPEM7 and unknownAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
JPZF1 CMV-TO-SCN1A-377(G2E, A104K, S109I)-deImmLink-NZF
Plasmid#236153PurposeExpress mutated SCN1A-14 zinc finger array (G2E, A104K, S109I) attached by a deimmunized linker to the NZF transcriptional activation domain, under control of CMV promoter with two TetR binding sitesDepositorInsertSCN1A-377-deImmLink-NZF
ExpressionMammalianMutationG2E, A104K, S109I in SCN1A-377PromoterCMV promoter with two TetR binding sitesAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRSF-G1(7CNW)RS
Plasmid#222874PurposetRNA synthetase/tRNA pair for the in vivo incorporation of 7-Cyano-L-Tryptophan (7-CN-Trp) into proteins in E. coli in response to the amber (TAG) codonDepositorInserttRNA synthetase
ExpressionBacterialPromoterT7Available SinceFeb. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB9
Plasmid#210036PurposeContains Cas9 gRNA cloning site, inducible Cas9, UCOE, puro-T2A-eGFPDepositorInsertsCas9
puro-T2A-eGFP
UseCRISPRTagsSV40 NLS and nucleoplasmin NLSExpressionMammalianPromoterEF-1α and TRE3GAvailable SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCIFR-6
Plasmid#227665PurposeIntegration of msfGFP (or your Module Of Interest) in a random fashion via Tn5 insertion. The antibiotic cassette (Gm) used for selecting for the integration can be removed in a later stage with pFNC.DepositorInsertmsfGFP
ExpressionBacterialPromoterp14G-BCD2Available SinceJan. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCIFR-4
Plasmid#227664PurposeIntegration of msfGFP (or your Module Of Interest) in a random fashion via Tn5 insertion. The antibiotic cassette (Sm) used for selecting for the integration can be removed in a later stage with pFNC.DepositorInsertmsfGFP
ExpressionBacterialPromoterp14G-BCD2Available SinceJan. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCIFR-2
Plasmid#227663PurposeIntegration of msfGFP (or your Module Of Interest) in a random fashion via Tn5 insertion. The antibiotic cassette (Km) used for selecting for the integration can be removed in a later stage with pFNC.DepositorInsertmsfGFP
ExpressionBacterialPromoterp14G-BCD2Available SinceJan. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFNC-6
Plasmid#227669PurposePlasmid encoding the BxbI phage integrase. It can be used to remove the antibiotic resistance cassette integrated with pCIFR. GmR, easily curable via sucrose counterselection.DepositorInsertsBxbI phage integrase
sacB
ExpressionBacterialPromoterPEM7Available SinceJan. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
CAG-mCherry
Plasmid#229135PurposeRetrovirus driving mCherry reporterDepositorInsertmCherry
UseRetroviralExpressionMammalianAvailable SinceJan. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFNC-4
Plasmid#227668PurposePlasmid encoding the BxbI phage integrase. It can be used to remove the antibiotic resistance cassette integrated with pCIFR. SmR, easily curable via sucrose counterselection.DepositorInsertSmR
ExpressionBacterialAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHIE324-ZF6x12-C DsRed-Express2 in TUPV1
Plasmid#201536PurposeDsRed-Express2 reporter regulated by ZF6 synTF promoter (12x compact binding sites) in TUPV1 for mMoClo golden gate-based assemblyDepositorInsertDsRed-Express2
ExpressionMammalianPromoterZF6x12(C)_YB_TATA Minimal PromoterAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
TadA-8e-eIscBn
Plasmid#227018PurposeVector encoding human codon-optimized enhanced-activity nOgeuIscB fusion with TadA8e driven by CMV promoterDepositorInsertbpNLS-TadA-8e-linker-nOgeuIscB-v3-bpNLS
MutationD96R/E84R/V159R/H339APromoterCMVAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
IscB-v3
Plasmid#227015PurposeVector encoding human codon-optimized enhanced-activity OgeuIscB driven by CMV promoterDepositorInsertSV40 NLS-OgeuIscB-v3-nucleoplasmin NLS
MutationD96R/E84R/V159RPromoterCMVAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
eIscB
Plasmid#227016PurposeVector encoding human codon-optimized enhanced-activity OgeuIscB fusion with extra SV40 NLS driven by CMV promoterDepositorInsertSV40 NLS-OgeuIscB-v3-SV40-nucleoplasmin NLS
MutationD96R/E84R/V159RPromoterCMVAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCHC024 (∆SH)
Plasmid#226202PurposeElectroporation knockout plasmid (pK18sB) to delete the C. necator soluble hydrogenase operon (deltaSH).DepositorInsertHomology arms for soluble hydrogenase operon
UseSynthetic BiologyMutation∆hoxFUYHWI ∆hypA2B2F2Available SinceNov. 18, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCHC023 (∆MBH)
Plasmid#226201PurposeElectroporation knockout plasmid (pK18sB) to delete the C. necator membrane-bound hydrogenase operon (deltaMBH).DepositorInsertHomology arms for membrane bound hydrogenase operon
UseSynthetic BiologyMutation∆hoxKGZMLOQRTV ∆hypA1B1F1CDEX ∆hoxABCJAvailable SinceNov. 18, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCHC022 (∆phcA)
Plasmid#226200PurposeElectroporation knockout plasmid (pK18sB) to delete the C. necator LysR-type transcriptional regulator PhcA.DepositorInsertHomology arms for PhcA
UseSynthetic BiologyAvailable SinceNov. 18, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCHC004 (∆phaCAB)
Plasmid#226198PurposeElectroporation knockout plasmid (pK18sB) to delete the C. necator phaCAB operon, to prevent accumulation of PHB.DepositorInsertHomology arms for phaCAB
UseSynthetic BiologyAvailable SinceNov. 15, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCHC027 (∆pemK)
Plasmid#226204PurposeConjugation knockout plasmid (pK18msB) to delete the C. necator addiction system toxin PemK, to enable deletion of the pHG1 megaplasmid.DepositorInsertUpstream/downstream homology arms for addiction system toxinPemK.
UseSynthetic BiologyAvailable SinceNov. 14, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
CB2R-GFP
Plasmid#208919Purposeencodes the human cannabinoid receptor 2, tagged with GFPDepositorAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28a-Fgß-FIVAR-ELP-HIS-ybbR
Plasmid#169136PurposeE. coli expression of FIVAR domain containing Fgß tag, ybbR tag and ELP linker. This construct was designed for AFM-SMFS measurements.DepositorInsertFIVAR (found in various architectures)
Tags3xELP linker, 6x Histag, Fgβ peptide, and ybbr ta…ExpressionBacterialAvailable SinceOct. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCM0-109
Plasmid#218200PurposeSV40 NLS for protein targeting to nucleusDepositorInsertSV40 NLS
UseSynthetic BiologyAvailable SinceSept. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMBS-858
Plasmid#218008PurposemVenus fluorescent proteinDepositorInsertmVenus
UseSynthetic BiologyAvailable SinceAug. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMBS-853
Plasmid#218011PurposemCerulean fluorescent proteinDepositorInsertmCerulean
UseSynthetic BiologyAvailable SinceAug. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMBS-854
Plasmid#218012PurposemVenus fluorescent proteinDepositorInsertmVenus
UseSynthetic BiologyAvailable SinceAug. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMBS-855
Plasmid#218013PurposemCherry fluorescent proteinDepositorInsertmCherry
UseSynthetic BiologyAvailable SinceAug. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMBS-856
Plasmid#218014PurposesfGFP fluorescent proteinDepositorInsertsfGFP
UseSynthetic BiologyAvailable SinceAug. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMBS-872
Plasmid#218015PurposeNanoLuc luminescence reporterDepositorInsertNanoLuc
UseSynthetic BiologyAvailable SinceAug. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMBS-860
Plasmid#218016PurposemVenus fluorescent proteinDepositorInsertmVenus
UseSynthetic BiologyAvailable SinceAug. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMBS-861
Plasmid#218017PurposemCerulean fluorescent proteinDepositorInsertmCerulean
UseSynthetic BiologyAvailable SinceAug. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMBS-871
Plasmid#218019Purpose8xHis-1xHA-tag for protein detection and purificationDepositorInsert8xHis-1xHA-tag
UseSynthetic BiologyAvailable SinceAug. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMBS-1022
Plasmid#218020Purpose8xHis-SP20-3xHA-tag for protein detection and purificationDepositorInsert8xHis-SP20-1xHA-tag
UseSynthetic BiologyAvailable SinceAug. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMBS-869
Plasmid#218021PurposeER retention signal (DGDL) for protein targeting to ERDepositorInsertER retention signal (DGDL)
UseSynthetic BiologyAvailable SinceAug. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCM0-101
Plasmid#218199PurposeMulti-Stop for adding 3 stops for each frameDepositorInsertMulti-Stop
UseSynthetic BiologyAvailable SinceAug. 30, 2024AvailabilityAcademic Institutions and Nonprofits only