We narrowed to 10,182 results for: yeast
-
Plasmid#29378DepositorInsertSUP45 gene encoding translation release factor 1 from S. cerevisiae (SUP45 Budding Yeast)
ExpressionYeastMutationN58A mutant gene including genomic sequence 1432 …Available SinceMay 23, 2011AvailabilityAcademic Institutions and Nonprofits only -
pRPB1-CTD14
Plasmid#112822PurposepSMF2 with 14 CTD repeatsDepositorInsertRPB1 (RPO21 Budding Yeast)
ExpressionYeastMutationCTD repeats have identical sequence, deleted repe…PromoterNative promoterAvailable SinceJuly 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJZC548
Plasmid#62316PurposesgRNA with 1x PP7 for yeast cellsDepositorInsertsgRNA + 1x PP7
ExpressionYeastPromoterSNR52Available SinceMarch 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTH375-SUP45-P174Q
Plasmid#29383DepositorInsertSUP45 gene encoding translation release factor 1 from S. cerevisiae (SUP45 Budding Yeast)
ExpressionYeastMutationP174Q mutant gene including genomic sequence 1432…Available SinceMay 23, 2011AvailabilityAcademic Institutions and Nonprofits only -
BB3aK_14*
Plasmid#98529Purposeempty BB3 for insertion and overexpression of 1 gene in P. pastorisDepositorTypeEmpty backboneExpressionBacterial and YeastAvailable SinceFeb. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
GTL-y
Plasmid#81100PurposeGene Tagging vector LEU/YFP - Plasmid for monomeric Citrine (mCitrine) labeling of endogenous proteins with a LEU selection marker, originating from pSIVl (ID:81090)DepositorInsertmCitrine
UseCre/LoxTagsmCitrineExpressionYeastMutationMutated mCitrine for monomeric isoform (A206K L22…Available SinceNov. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJT79_GalL_nCDA1Δ192-BE3
Plasmid#145045PurposeExpresses nCDA1Δ192-BE3 in yeast cellsDepositorInsertnCDA1Δ192-BE3
UseCRISPRExpressionYeastMutationpmCDA1(1-192AA); spCas9(D10A)PromoterGalLAvailable SinceJuly 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
ZJOM8
Plasmid#133671PurposeIntegration of SNF7-GFP as an additional copy in genome, use auxotrophic marker URA3(Candida albicans). Present on endosomes and vacuolar surface.DepositorAvailable SinceFeb. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pNB785
Plasmid#60164PurposeFirefly luciferase (Promega) yeast codon-optimized yellow fluorescent protein (yEVenus) fusion with PEST degron driven by SIC1 promoter.DepositorInsertFLuc-yEVenus-PEST
TagsPEST degronExpressionYeastMutationFLuc has A4V & S504G (no functional effect)PromoterSIC1prAvailable SinceMarch 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRPB1-CTD8
Plasmid#112820PurposepSMF2 with 8 CTD repeatsDepositorInsertRPB1 (RPO21 Budding Yeast)
ExpressionYeastMutationCTD repeats have identical sequence, deleted repe…PromoterNative promoterAvailable SinceJuly 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRPB1-CTD10
Plasmid#112821PurposepSMF2 with 10 CTD repeatsDepositorInsertRPB1 (RPO21 Budding Yeast)
ExpressionYeastMutationCTD repeats have identical sequence, deleted repe…PromoterNative promoterAvailable SinceJuly 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
BB3rN_AH
Plasmid#98556Purposeempty BB3 for insertion and overexpression of 7 genes in P. pastorisDepositorTypeEmpty backboneExpressionBacterial and YeastAvailable SinceFeb. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pNB787
Plasmid#60152PurposeFirefly luciferase (Promega) and yeast codon-optimized yellow fluorescent protein (yEVenus) fusion with PEST degron driven by LEU1 promoter.DepositorInsertFLuc-yEVenus-PEST
TagsPEST degronExpressionYeastMutationFLuc has A4V & S504G (no functional effect)PromoterLEU1prAvailable SinceMarch 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pNB789
Plasmid#60166PurposeFirefly luciferase (Promega) yeast codon-optimized yellow fluorescent protein (yEVenus) fusion with PEST degron driven by RNR1 promoter.DepositorInsertFLuc-yEVenus-PEST
TagsPEST degronExpressionYeastMutationFLuc has A4V & S504G (no functional effect)PromoterRNR1prAvailable SinceMarch 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
GTL-ir
Plasmid#81102PurposeGene Tagging vector LEU/iRFP - Plasmid for tandem infrared RFP (tdiRFP) labeling of endogenous proteins with a LEU selection marker, originating from pSIVl (ID:81090)DepositorInserttdiRFP
UseCre/LoxTagstdiRFPExpressionYeastMutationcodon optimized second iRFP to avoid internal rec…Available SinceNov. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
GTT-y
Plasmid#81110PurposeGene Tagging vector TRP/YFP - Plasmid for monomeric Citrine (mCitrine) labeling of endogenous proteins with a TRP selection marker, originating from pSIVt (ID:81092)DepositorInsertmCitrine
UseCre/LoxTagsmCitrineExpressionYeastMutationMutated mCitrine for monomeric isoform (A206K L22…Available SinceNov. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-GFP (F64L, S65T, V163A)-His3MX6
Plasmid#53185Purposechromosomal tagging with stable GFPDepositorAvailable SinceMay 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
-
pCY5.1kh
Plasmid#160297PurposeYeast CRISPR plasmid targeting the kanMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only