We narrowed to 20,298 results for: Cre
-
Plasmid#207379PurposeExpression of increased-fidelity (i.e. high-fidelity) SpCas9 variant in bacterial cellsDepositorInserteSpCas9
UseCRISPRTags6xHisExpressionBacterialMutationK848A, K1003A, R1060APromoterT7Available SinceSept. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
CRISPseq-BFP-backbone
Plasmid#85707PurposeBackbone for CRISPR/Cas9 screening with single cell RNA-seq. Lentiviral plasmid for cloning of gRNAs and Unique Guide Index (UGI), with a BFP fluorescent marker. Does NOT include Cas9.DepositorTypeEmpty backboneUseLentiviralAvailable SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMax_mOrange_A215C
Plasmid#177828PurposeSite-specific mutagenesis of mOrange for the purposes of creating a site-specific 8-oxo-G:C lesion for the purposes of measuring OGG1 activity via Host Cell Reactivation (HCR).DepositorInsertmOrange_A215C
ExpressionMammalianMutationA215CPromoterCMVAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMax_GFP_C289T
Plasmid#177826PurposeSite-specific mutagenesis of GFP for the purposes of creating a site-specific hypoxanthine lesion for the purposes of measuring MPG activity via Host Cell Reactivation (HCR).DepositorInsertGFP_C289T
ExpressionMammalianMutationC289TPromoterCMVAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCPP3373
Plasmid#128718PurposePhytopathogen Pseudomonas syringae pv. tomato type III secretion system effector (gene lacking stop codon) Gateway donor cloneDepositorInserthopQ1-1
ExpressionBacterialMutationSynonymous point mutation in the wobble position…Available SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRSFDuet-gst-xr
Plasmid#214761PurposeXylose reductase from Hypocrea jecorina fused with GST-tagged and codon optimized for expression in E. coliDepositorInsertglutathione S-transferases fused with xylose reductase
TagsGlutathione S-transferasesExpressionBacterialPromoterT7Available SinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
NLS-AgDD
Plasmid#80625Purposecreate nuclear protein aggregates in mammalian cellsDepositorAvailable SinceAug. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMax_BFP_A191G
Plasmid#177823PurposeSite-specific mutagenesis of tagBFP for the purposes of creating a site-specific U:A mispair for the purposes of measuring UDG activity via Host Cell Reactivation (HCR).DepositorInserttagBFP_A191G
ExpressionMammalianMutationA191GPromoterCMVAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-OC-IRES-BSD
Plasmid#53118PurposeTo create stable cell clones with high-level expression of Cas9 and OCT1DepositorInsertsUseLentiviralTagsIRES-BSD, NLS, and P2AExpressionMammalianMutationhuman codon-optimizedPromoterCMVAvailable SinceMay 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
CRISPseq-mCherry-backbone
Plasmid#85708PurposeBackbone for CRISPR/Cas9 screening with single cell RNA-seq. Lentiviral plasmid for cloning of gRNAs and Unique Guide Index (UGI), with an mCherry fluorescent marker. Does NOT include Cas9.DepositorTypeEmpty backboneUseLentiviralAvailable SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
CRISPR-StAR2 (Retro)
Plasmid#222688PurposeCRISPR-screeningDepositorTypeEmpty backboneUseCRISPR and RetroviralExpressionMammalianMutationPGK without BbsI cutsiteAvailable SinceDec. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
CRISPR-StAR3 (Retro)
Plasmid#222689PurposeCRISPR-screeningDepositorTypeEmpty backboneUseCRISPR and RetroviralExpressionMammalianMutationPGK without BbsI cutsiteAvailable SinceDec. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCPP5233
Plasmid#128715PurposePhytopathogen Pseudomonas syringae pv. tomato type III secretion system effector (gene lacking stop codon) and chaperone Gateway donor cloneDepositorInsertshcM-hopM1
ExpressionBacterialAvailable SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCRISPReporter-mCherry
Plasmid#65008PurposeE. coli reporter vector with MCS for inserting bacterial promoter region through 5' end of gene of interest, upstream and in-frame with mCherry reporter.DepositorInsertmCherry
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterUser-definedAvailable SinceMay 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCPP5060
Plasmid#128716PurposePhytopathogen Pseudomonas syringae pv. tomato type III secretion system effector (gene lacking stop codon) and chaperone Gateway donor cloneDepositorInsertshcN-hopN1
ExpressionBacterialAvailable SinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
RS35075_pMQ30_KO_Kan
Plasmid#185390PurposeNon-replicating vector used to create markerless deletion of RR42_RS35075 in C. basilensis 4G11DepositorInsertsRR42_RS35075 upstream flanking homology region
RR42_RS35075 downstream flanking homology region
nptII kanamycin resistance marker
ExpressionBacterialAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSNV2 CHER NLS cop1at(335-675)
Plasmid#44972DepositorInsertmCherry-NLS-COP1 (COP1 Mustard Weed)
TagsNLS and mCherryExpressionMammalianMutationdeleted amino acids 1-334PromoterpCMV IEAvailable SinceJune 6, 2013AvailabilityAcademic Institutions and Nonprofits only -
JI401: Ad5 E1A/Hexon qRT-PCR standard
Plasmid#131753PurposePlasmid standard containing regions of the Ad5 E1A and Ad5 Hexon genes to create a qRT-PCR standard curve for detection of replication competent adenovirus (RCA).DepositorInsertsAd5 E1A gene fragment
Ad5 Hexon gene fragment
UseStandard for qrt-pcrPromoterN/AAvailable SinceOct. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
Pvha6-AgDD
Plasmid#80626Purposecreate protein aggregates in C. elegansDepositorAvailable SinceAug. 8, 2016AvailabilityAcademic Institutions and Nonprofits only