We narrowed to 10,522 results for: SEC
-
Plasmid#23121DepositorAvailable SinceMarch 3, 2010AvailabilityAcademic Institutions and Nonprofits only
-
pOTTC2185 - pAAV nEF ConFoff hChR2(H134R)-mCherry
Plasmid#202546PurposeAn INTRSECT-ready adeno-associated viral vector expressing channelrhodopsin2-mCherry fusion (Cre-On and Flp-Off)DepositorInserthChR2(H134R)-mCherry
UseAAVPromoternEFAvailable SinceFeb. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pOTTC2186 - pAAV nEF CoffFon hChR2(H134R)-mCherry
Plasmid#202547PurposeAn INTRSECT-ready adeno-associated viral vector expressing channelrhodopsin2-mCherry fusion (Cre-Off and Flp-On)DepositorInserthChR2(H134R)-mCherry
UseAAVPromoternEFAvailable SinceFeb. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
PX458 BLTP3A knockout
Plasmid#241256PurposeKnock-out plasmid targeting the second exon of human BLTP3A (UHRF1BP1)DepositorInsertBLTP3A (UHRF1BP1) KO gRNA (BLTP3A Human)
ExpressionMammalianAvailable SinceNov. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPIC9K_A2AR_316_V229C_R293A
Plasmid#246918PurposeExpress A2AR mutants in Pichia PastorisDepositorInsertAdenosine A2A receptor (ADORA2A Human)
Tags10xHis and alpha-factor secretion signal, FLAGExpressionYeastMutationtruncated to aa 1-316, V229C, R293APromoterAOX1Available SinceNov. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPIC9K_A2AR_316_V229C_R291AR293A
Plasmid#246919PurposeExpress A2AR mutants in Pichia PastorisDepositorInsertAdenosine A2A receptor (ADORA2A Human)
Tags10xHis and alpha-factor secretion signal, FLAGExpressionYeastMutationtruncated to aa 1-316, V229C, R291A, R293APromoterAOX1Available SinceNov. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT2BR
Plasmid#221827PurposePlasmid to express gRNA1 (ttcagtttgcccggtttaac) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-d5-HT2BR
Plasmid#221828PurposePlasmid to express gRNA2 (aggcactcgtgctcgaatag) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-for-dSERT
Plasmid#221830PurposePlasmid to express gRNA1 (cgaaatctgcgctctacttg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-for-dSERT
Plasmid#221831PurposePlasmid to express gRNA2 (gggattcgagcggcccgtcg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pACUH 5-HT7R-7xGFP11-HA
Plasmid#221836PurposePlasmid for generating 10xUAS-5-HT7R-7xGFP11-HA transgenic flies with attP/attB integration. It carries the attB sequence.DepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEW66
Plasmid#232794PurposeCOMPASS Fragment 1 (Cps60, Cps50, Cps35, Cps25, Cps15) in PBIG1aDepositorInsertTagsNo tagsExpressionInsectPromoterpolyhedrin promoterAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
GMR11F02-Gal4 UAS-GFP
Plasmid#230907PurposeTissue-specific expression of GFP in wing and haltere imaginal discs.DepositorInsertGFP
ExpressionInsectPromoterGMR11F02Gal4-UASAvailable SinceFeb. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
MZB222
Plasmid#221772PurposeBacterial expression of 10xHis-SUMO (Smt3) fusion to Sec7 domain (687-885) of Big1 (ArfGEF1) for rapid nucleotide exchange and activation of Arf GTPasesDepositorAvailable SinceJan. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG94-9
Plasmid#228968PurposeFor bacterial expression of anti-GFP nanobody LaG94-9, with pelB leader for periplasmic secretion, and C-term free cysteine and 6xHIS tag.DepositorInsertLaG94-9
Tags6xHISExpressionBacterialPromoterT7Available SinceJan. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG94-10
Plasmid#228969PurposeFor bacterial expression of anti-GFP nanobody LaG94-10, with pelB leader for periplasmic secretion, and C-term free cysteine and 6xHIS tag.DepositorInsertLaG94-10
Tags6xHISExpressionBacterialPromoterT7Available SinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG94-12
Plasmid#228970PurposeFor bacterial expression of anti-GFP nanobody LaG94-12, with pelB leader for periplasmic secretion, and C-term free cysteine and 6xHIS tag.DepositorInsertLaG94-12
Tags6xHISExpressionBacterialPromoterT7Available SinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG94-3
Plasmid#228963PurposeFor bacterial expression of anti-GFP nanobody LaG94-3, with pelB leader for periplasmic secretion, and C-term free cysteine and 6xHIS tag.DepositorInsertLaG94-3
Tags6xHISExpressionBacterialPromoterT7Available SinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG94-8
Plasmid#228967PurposeFor bacterial expression of anti-GFP nanobody LaG94-8, with pelB leader for periplasmic secretion, and C-term free cysteine and 6xHIS tag.DepositorInsertLaG94-8
Tags6xHISExpressionBacterialPromoterT7Available SinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG94-6
Plasmid#228966PurposeFor bacterial expression of anti-GFP nanobody LaG94-6, with pelB leader for periplasmic secretion, and C-term free cysteine and 6xHIS tag.DepositorInsertLaG94-6
Tags6xHISExpressionBacterialPromoterT7Available SinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG94-18
Plasmid#228972PurposeFor bacterial expression of anti-GFP nanobody LaG94-18, with pelB leader for periplasmic secretion, and C-term free cysteine and 6xHIS tag.DepositorInsertLaG94-18
Tags6xHISExpressionBacterialPromoterT7Available SinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaTdT-2
Plasmid#228975PurposeFor bacterial expression of anti-tdTomato nanobody LaTdT-2, with pelB leader for periplasmic secretion, and C-term free cysteine and 6xHIS tag.DepositorInsertLaTdT-2
Tags6xHISExpressionBacterialPromoterT7Available SinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaGIgG-4
Plasmid#228998PurposeFor bacterial expression of anti-mouse IgG nanobody LaMIgG-4, with pelB leader for periplasmic secretion, and C-term free cysteine and C-term 6xHIS tag.DepositorInsertLaGIgG-4
Tags6xHISExpressionBacterialPromoterT7Available SinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG94-2
Plasmid#228962PurposeFor bacterial expression of anti-GFP nanobody LaG94-2, with pelB leader for periplasmic secretion, and C-term free cysteine and 6xHIS tag.DepositorInsertLaG94-2
Tags6xHISExpressionBacterialPromoterT7Available SinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG94-1
Plasmid#228961PurposeFor bacterial expression of anti-GFP nanobody LaG94-1, with pelB leader for periplasmic secretion, and C-term free cysteine and 6xHIS tag.DepositorInsertLaG94-1
Tags6xHISExpressionBacterialPromoterT7Available SinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaMIgG-9
Plasmid#228993PurposeFor bacterial expression of anti-mouse IgG nanobody LaMIgG-9, with pelB leader for periplasmic secretion, and C-term free cysteine and C-term 6xHIS tag.DepositorInsertLaMIgG-9
Tags6xHISExpressionBacterialPromoterT7Available SinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaMIgG-8
Plasmid#228992PurposeFor bacterial expression of anti-mouse IgG nanobody LaMIgG-8, with pelB leader for periplasmic secretion, and C-term free cysteine and C-term 6xHIS tag.DepositorInsertLaMIgG-8
Tags6xHISExpressionBacterialPromoterT7Available SinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaTdT-10
Plasmid#228978PurposeFor bacterial expression of anti-tdTomato nanobody LaTdT-10, with pelB leader for periplasmic secretion, and C-term free cysteine and 6xHIS tag.DepositorInsertLaTdT-10
Tags6xHISExpressionBacterialPromoterT7Available SinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaG94-4
Plasmid#228964PurposeFor bacterial expression of anti-GFP nanobody LaG94-4, with pelB leader for periplasmic secretion, and C-term free cysteine and 6xHIS tag.DepositorInsertLaG94-4
Tags6xHISExpressionBacterialPromoterT7Available SinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaTdT-8
Plasmid#228976PurposeFor bacterial expression of anti-tdTomato nanobody LaTdT-8, with pelB leader for periplasmic secretion, and C-term free cysteine and 6xHIS tag.DepositorInsertLaTdT-8
Tags6xHISExpressionBacterialPromoterT7Available SinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaTdT-9
Plasmid#228977PurposeFor bacterial expression of anti-tdTomato nanobody LaTdT-9, with pelB leader for periplasmic secretion, and C-term free cysteine and 6xHIS tag.DepositorInsertLaTdT-9
Tags6xHISExpressionBacterialPromoterT7Available SinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3puro-mGFP-FXR1a-CC1-CC1
Plasmid#225458PurposeExpress EGFP-fusion protein of FXR1 isoform a (CC1-CC1)DepositorInsertFXR1 isoform a (FXR1 Human)
TagsEGFPExpressionMammalianMutationCC2 replaced with a second copy of CC1PromoterCMVAvailable SinceOct. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3puro-mGFP-FXR1a-CC2-CC2
Plasmid#225459PurposeExpress mEGFP-fusion protein of FXR1 isoform a (CC2-CC2)DepositorInsertFXR1 isoform a (FXR1 Human)
TagsmEGFPExpressionMammalianMutationCC1 replaced with a second copy of CC2PromoterCMVAvailable SinceOct. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1-NOT1 isoform C-mCherry-PH (EB5)
Plasmid#206474PurposeNOT1 expression in Schneider cells for imagingDepositorAvailable SinceJuly 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1-PH-mCherry-Oskar 388-606 (OSK domain) (HK75)
Plasmid#206463PurposeOskar 388-606 expression in Schneider cells for imagingDepositorAvailable SinceJuly 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1-EGFP-Aubergine 4R-K (R11K/R13K/R15K/R17K) (HK121)
Plasmid#206433PurposeAubergine expression in Schneider cells for imagingDepositorAvailable SinceJuly 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1-EGFP-Vasa open (K295N) (RR228)
Plasmid#206435PurposeVasa expression in Schneider cells for imagingDepositorAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1-mEGFP-human FRB (HK168)
Plasmid#206443PurposeFRB expression in Schneider cells for imagingDepositorAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1-mEGFP-human MDM2 1-118 (HK181)
Plasmid#206444PurposeMDM2 1-118 expression in Schneider cells for imagingDepositorAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1-mCherry-Bruno isoform A (JM78)
Plasmid#206446PurposeBruno expression in Schneider cells for imagingDepositorAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only