We narrowed to 12,043 results for: shRNA
-
Plasmid#164988PurposeExpression of gRNA targeting HLA-DPA locus, including DPA1*02:01:08DepositorInsertgRNA against HLA-DPA1*02:01:08
UseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT004
Plasmid#182714PurposeConstituitvely expressed CasRx crRNA cloning vector, extended 3' terminator regionDepositorInsertCasRx crRNA cloning backbone
UseCRISPRExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB9339 (pgRNA_VII-1_NatMX)
Plasmid#161591PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site VII-1DepositorInsertguiding RNA
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB9340 (pgRNA_VIII-1_NatMX)
Plasmid#161592PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site VIII-1DepositorInsertguiding RNA
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB9341 (pgRNA_IX-1_NatMX)
Plasmid#161593PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site IX-1DepositorInsertguiding RNA
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB9342 (pgRNA_XIII-1_NatMX)
Plasmid#161594PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XIII-1DepositorInsertguiding RNA
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB9343 (pgRNA_XV-1_NatMX)
Plasmid#161595PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XV-1DepositorInsertguiding RNA
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB9344 (pgRNA_XVI-1_NatMX)
Plasmid#161596PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XVI-1DepositorInsertguiding RNA
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
px459-Pole4 KO sgRNA
Plasmid#186935PurposePole4 KO in mouse ES cellsDepositorAvailable SinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
px459-Pole3 KO sgRNA
Plasmid#186934PurposePole3 KO in mouse ES cellsDepositorAvailable SinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
1056D
Plasmid#183132PurposePlasmid supports expression of 2 gRNAs targeting D.suzukii bTub, Opie-mVenus tagged, and can be integrated with pBac.DepositorInsertU6.3-gRNAs[bTub]
UseCRISPRExpressionInsectAvailable SinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
1056E
Plasmid#183133PurposePlasmid supports expression of 2 gRNAs targeting D.suzukii dsx, Opie-mVenus tagged, and can be integrated with pBac.DepositorInsertU6.3-gRNAs[dsx]
UseCRISPRExpressionInsectAvailable SinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
1056F
Plasmid#183134PurposePlasmid supports expression of 2 gRNAs targeting D.suzukii tra, Opie-mVenus tagged, and can be integrated with pBac.DepositorInsertU6.3-gRNAs[tra]
UseCRISPRExpressionInsectAvailable SinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-CfANLN_sgRNA
Plasmid#183880PurposepX459V2.0-HypaCas9 plasmid with cfANLN sgRNA for N-terminal tagging of anillin in canine (Canis familiaris) cells.DepositorInsertCanis familiaris ANLN sgRNA spacer
UseCRISPRExpressionMammalianPromoterU6Available SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK14 pCAS-Tyr-[gRNA: 4=XII-5] (SplitKanR, AmpR)
Plasmid#178998PurposeSp.Cas9 and gRNA yeast expression vector withXII-5 gRNA pre-cloned. Selection =SplitKanamycin resistanceDepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK13 pCAS-Tyr-[gRNA: 3=XII-2] (SplitKanR, AmpR)
Plasmid#178997PurposeSp.Cas9 and gRNA yeast expression vector with XII-2 gRNA pre-cloned. Selection =SplitKanamycin resistanceDepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOC4 Grin1-smFP-V5 KI
Plasmid#183439PurposeFlpON knock-in for GluN1-smFP-V5 (amino acid position: A20)DepositorInsertgRNA and smFP V5 donor
UseCRISPRExpressionMammalianAvailable SinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-tdTomato166/892
Plasmid#179919PurposeDouble cutting Cas9 plasmid with puromycin resistance and a single guide RNA targeting tdTomato fluorescent protein sites 166 and 892.DepositorInserttdTomato sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX458_sgRNA_Ago1_5
Plasmid#172470PurposeExpresses SpCas9, GFP, and sgRNA targeting Ago1DepositorInsertsgAgo1
UseCRISPRExpressionMammalianPromoterhU6Available SinceMarch 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX458_sgRNA_Ago1_6
Plasmid#172471PurposeExpresses SpCas9, GFP, and sgRNA targeting Ago1.DepositorInsertsgAgo1
UseCRISPRExpressionMammalianPromoterhU6Available SinceMarch 24, 2022AvailabilityAcademic Institutions and Nonprofits only