We narrowed to 23,593 results for: promoter
-
-
pRPa-c6MYCn
Plasmid#69242PurposeTet-inducible RRNA promoter driven plasmid for expression of N or C-terminally c-Myc tagged protein from a specific RRNA spacer locus in T. brucei.DepositorTypeEmpty backboneUseExpression in trypanosoma bruceiTagscMycPromoterRRNA promoterAvailable SinceOct. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRP-c6MYCn
Plasmid#69243PurposeTet-inducible RRNA promoter driven plasmid for inducible expression of N- or C-terminally c-Myc tagged protein from a random RRNA spacer locus in T. brucei.DepositorTypeEmpty backboneUseExpression in trypanosoma bruceiTagscMycPromoterRRNA promoterAvailable SinceOct. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRPa-iSL(MCS3+4)
Plasmid#69246PurposeTet-inducible RRNA promoter driven plasmid for the generation of stem loop RNAi transcripts from a specific RRNA spacer locus in T. brucei.DepositorTypeEmpty backboneUseExpression in trypanosoma bruceiPromoterRRNA promoterAvailable SinceOct. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7 Alk.2 shRNA
Plasmid#59297PurposeshRNA to mouse AlkDepositorInsertAlk.2 shRNA
UseCre/Lox, Lentiviral, and RNAiExpressionMammalianPromotermouse U6Available SinceAug. 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGL2 enhancer- F3 GATA mut
Plasmid#22430DepositorAvailable SinceFeb. 17, 2010AvailabilityAcademic Institutions and Nonprofits only -
pGL2 enhancer- F4 GATA mut
Plasmid#22435DepositorAvailable SinceFeb. 17, 2010AvailabilityAcademic Institutions and Nonprofits only -
pGL2 enhancer- F6 Sp-1 mut
Plasmid#22439DepositorAvailable SinceFeb. 4, 2010AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-rB50
Plasmid#18957DepositorInsertBrevican N-terminus (Bcan Rat)
ExpressionMammalianMutationBrevican N-terminus, aminoacids 1-395Available SinceDec. 12, 2008AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-dCas9-p300 Core
Plasmid#61357Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human p300 HAT core (aa 1048-1664) driven by CMV promoterDepositorInsertS.pyogenes dCas9 with c-terminal human p300 Core effector fusion (aa 1048-1664 of human p300) (EP300 Human, Synthetic, S. pyogenes)
UseCRISPR and Synthetic BiologyTagsFlag, HA, and SV40 NLSExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterCMVAvailable SinceApril 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-dCas9-p300 Core (D1399Y)
Plasmid#61358Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human p300 HAT core (aa 1048-1664; inactivating mutation D1399Y) driven by CMV promoterDepositorInsertS.pyogenes dCas9 with c-terminal human p300 Core effector fusion (aa 1048-1664 of human p300) (EP300 Human, Synthetic, S. pyogenes)
UseCRISPR and Synthetic BiologyTagsFlag, HA, and SV40 NLSExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9; D1399Y mutation i…PromoterCMVAvailable SinceApril 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGGG-AH-VRT-A2
Plasmid#163703PurposeWheat transformation vector pGoldenGreenGate (pGGG) with OsActinP:: hygromycin (hpt) selection and the full native Triticum polonicum VRT-A2 gene (native prom::genomic seq::3'UTR)DepositorInsertsOs Actin promoter :: Hygromycin resistance gene (hpt) containing CAT1 intron :: NosTerminator
Triticum polonicum VRT-A2 genomic sequence (Native promoter:: genomic sequence::3'UTR) + Nos Terminator
ExpressionPlantPromoterRice - Os Actin promoter and Triticum polonicum V…Available SinceJan. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-dCas9-p300 Core (Y1467F)
Plasmid#61362Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human p300 HAT core (aa 1048-1664; inavtivating mutation Y1467F) driven by CMV promoterDepositorInsertS.pyogenes dCas9 with c-terminal human p300 Core effector fusion (aa 1048-1664 of human p300) (EP300 Human, Synthetic, S. pyogenes)
UseCRISPR and Synthetic BiologyTagsFlag, HA, and SV40 NLSExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9; Y1467F mutation i…PromoterCMVAvailable SinceApril 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
TOPO-HIF1A
Plasmid#226452PurposeFor subcloning of human HIF1A promoter or for assays using M13 phageDepositorAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1a-KIF5A-HA-IRES-Puro
Plasmid#166952PurposeLentiviral plasmid expressing HA-tagged KIF5A protein with IRES-Puro from the EF1a promoterDepositorAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-Nppa-EGFP
Plasmid#247327PurposeExpresses EGFP under the control of the Nppa promoterDepositorInsertEGFP under the control of the Nppa Promoter
UseAAVExpressionMammalianPromoterNppa proximal promoterAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 38t3 thsS(t3)R-bARGSer
Plasmid#232468PurposeOptimized thiosulfate sensor with acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
TOPO-EXOC3 (-1557 to-1046)
Plasmid#226446PurposeFor subcloning of human EXOC3 promoter (base pairs -1557 to-1046) or for assays using M13 phageDepositorAvailable SinceSept. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
TOPO-EXOC3 (-2455 to -1951)
Plasmid#226441PurposeFor subcloning of human EXOC3 promoter (base pairs -2455 to -1951) or for assays using M13 phageDepositorAvailable SinceJuly 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
TOPO-EXOC3 (-1592 to -1046)
Plasmid#226444PurposeFor subcloning of human EXOC3 promoter (base pairs -1592 to -1046) or for assays using M13 phageDepositorAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only
