We narrowed to 171,128 results for: Gene

#193225

Lentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Notch2 gene

Julien Sage

Lee et al Cell Rep. 2023 Jan 13;42(1):111990. doi:

Dec. 13, 2022

Academic Institutions and Nonprofits only

#193236

Lentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Runx1t1 gene

Julien Sage

Lee et al Cell Rep. 2023 Jan 13;42(1):111990. doi:

Dec. 12, 2022

Academic Institutions and Nonprofits only

#193242

Lentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Tmem132d gene

Julien Sage

Lee et al Cell Rep. 2023 Jan 13;42(1):111990. doi:

Dec. 12, 2022

Academic Institutions and Nonprofits only

#193243

Lentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Tmem132d gene

Julien Sage

Lee et al Cell Rep. 2023 Jan 13;42(1):111990. doi:

Dec. 12, 2022

Academic Institutions and Nonprofits only

#193248

Lentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Zfp536 gene

Julien Sage

Lee et al Cell Rep. 2023 Jan 13;42(1):111990. doi:

Dec. 12, 2022

Academic Institutions and Nonprofits only

#193239

Lentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Spen gene

Julien Sage

Lee et al Cell Rep. 2023 Jan 13;42(1):111990. doi:

Dec. 12, 2022

Academic Institutions and Nonprofits only

#193240

Lentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Spen gene

Julien Sage

Lee et al Cell Rep. 2023 Jan 13;42(1):111990. doi:

Dec. 12, 2022

Academic Institutions and Nonprofits only

#193228

Lentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Notch3 gene

Julien Sage

Lee et al Cell Rep. 2023 Jan 13;42(1):111990. doi:

Dec. 12, 2022

Academic Institutions and Nonprofits only

#193249

Lentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Zfp536 gene

Julien Sage

Lee et al Cell Rep. 2023 Jan 13;42(1):111990. doi:

Dec. 12, 2022

Academic Institutions and Nonprofits only

#193235

Lentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Runx1t1 gene

Julien Sage

Lee et al Cell Rep. 2023 Jan 13;42(1):111990. doi:

Dec. 12, 2022

Academic Institutions and Nonprofits only

#193227

Lentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Notch3 gene

Julien Sage

Lee et al Cell Rep. 2023 Jan 13;42(1):111990. doi:

Dec. 9, 2022

Academic Institutions and Nonprofits only

#154058

Level 1, Position 3 Golden Gate vector. ZmUbi-5'UTR:loxP-GUS-nosT-loxP-NAM-B1-nosT

Cristobal Uauy

Harrington et al Plant Methods. 2020 Oct 14;16:137. doi:

Sept. 29, 2020

Academic Institutions and Nonprofits only

#87408

p426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#49966

Expresses a TALE-TET1CD (catalytic domain of TET1) fusion protein engineered to bind a site in the human beta-globin (HBB) gene and demethylate CpGs adjacent to the binding site

Keith Joung

Maeder et al Nat Biotechnol. 2013 Oct 9. doi: 10.1038

Dec. 10, 2013

Academic Institutions and Nonprofits only