We narrowed to 9,640 results for: try
-
Plasmid#176017PurposeMultisite gateway middle entry clone containing zebrafish Cavin4b_PRDmt with no stop codon. Parton lab clone JLY.DepositorInsertCavin4b (PRDmt) (cavin4b Zebrafish)
UseGateway entry cloneAvailable SinceNov. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
p3E-BIN1_tv8
Plasmid#126574PurposeMultisite gateway middle entry vector containing human BIN1 transcriptional variant 8 (muscle specific) with no ATG. Parton lab clone DVA.DepositorInsertBIN1 (BIN1 Human)
UseGateway entry cloneAvailable SinceNov. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
BPV00914 pET21GG2 H6-TF-BECN (1-450) [VA-MA-LA]
Plasmid#136688PurposeExpresses the full-length Beclin-1 protein (a.a. 1-450) with a N-terminal hexa-Histidine and solubility tag (i.e., Trigger Factor). Three mutations are added to the CC and ECD/BARA interface.DepositorInsertBeclin-1 (BECN1 Human)
TagsTrigger FactorExpressionBacterialMutationDNA optimized for E. coli expression w/ three mut…PromoterT7Available SinceFeb. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pOEM1_pCMV:deltaN-bmp4-pPH:vsvged
Plasmid#111158PurposeBaculovirus rescue vector, VSVGED pseudotype, hShhDepositorInsertdeltaNhBmp4 (BMP4 Human)
UseBaculoviral rescue shuttle vectorExpressionInsect and MammalianMutationdelta N, mutant BMP lacking the N terminus (delta…PromoterCMVAvailable SinceJune 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEN_TT 3XFLAG-S37A-GATA6-3XAU1_RNAi resistant
Plasmid#72924PurposeGateway entry vector for an inducible N-terminally 3XFLAG-tagged and C-terminally AU1-tagged, RNAi resistant human S37A-GATA6DepositorInsertGATA Binding Protein 6 (GATA6 Human)
UseEntry vector for gateway cloningTags3XAU1 and 3XFLAGExpressionBacterialMutationSerine#37 changed to Alanine;Silent mutations mad…PromoterTRE tightAvailable SinceJuly 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
tetO-ASCL1-LMX1b-NURR1-PuroR
Plasmid#182298PurposeDoxycycline-inducible vector expressing the ALN transcription factors and PuroR (all separated by 2A sequences)DepositorAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLCKO-CMV-Blasticidin-P2A-3xHA-TMEM106B_Human
Plasmid#238130PurposeThis plasmid encodes the full-length human TMEM106B protein fused with a 3xHA tag, along with an N-terminal blasticidin selection marker.DepositorInsertTMEM106B (TMEM106B Human)
UseLentiviralTagsBlasticidin-P2A-3xHAExpressionMammalianPromoterCMVAvailable SinceJune 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-MCP-dNS-SRRM1-V5-mCherry
Plasmid#235095PurposeSRRM1 lacking Nuclear Speckle domain (dNS-SRRM1) mCherry fusion protein with MCP domainDepositorInsertpCAG-MCP-dNS-SRRM1-V5-mCherry (SRRM1 Human)
ExpressionMammalianMutationThe SRRM1 entry clone from DNASU was modified usi…PromoterCAGAvailable SinceMay 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCR8 JARID2
Plasmid#114443PurposeEntry vector for gateway cloning containing human JARID2 coding sequenceDepositorAvailable SinceSept. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Ef1a-mClover-W377A/W428A YTHDC1-T2A-BSD-siRNA-Resistant
Plasmid#177130PurposeGenerate lentivirus to introduce mClover tagged m6A binding null mutant W377A/W428A YTHDC1DepositorInsertYTHDC1 (YTHDC1 Human)
UseLentiviralTagsmClover3MutationW428A/W377A (m6A binding defects), and siRNA resi…PromoterEf1aAvailable SinceJuly 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLCKO-CMV-TMEM106B-P2A-Blasticidin
Plasmid#237478PurposeEncodes full length human TMEM106B protein, along with blasticidin selection marker.DepositorInsertTMEM106B (TMEM106B Human)
UseLentiviralTagsP2A-BlasticidinExpressionMammalianPromoterCMVAvailable SinceJune 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-SpyTag-Flag-dNS-SRRM1-V5-mCherry
Plasmid#235096PurposeSRRM1 lacking Nuclear Speckle domain (dNS-SRRM1) mCherry fusion protein without MCP domainDepositorInsertpCAG-SpyTag-Flag-dNS-SRRM1-V5-mCherry (SRRM1 Human)
ExpressionMammalianMutationThe SRRM1 entry clone from DNASU was modified usi…PromoterCAGAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTXBI-mClover-YTH domain
Plasmid#177123PurposeBacterial expression of YTH domain of YTHDC1 tagged with N-terminal mClover3 and C-terminal Mxe GtrA intein-Chitin binding domain for protein purificationDepositorInsertYTHDC1 (YTH domain) (YTHDC1 Human)
TagsMxe GyrA intein-Chitin binding domain for protein…ExpressionBacterialMutationYTH domain only (IDR1 and IDR2 deletion)PromoterT7Available SinceJan. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pME-mCherry-PA-Rac1
Plasmid#169042PurposeMiddle entry vector for Gateway cloning that contains an mCherry fused with an optimized photoactivatable Rac1 gene insertDepositorInsertPA-Rac-1 (RAC1 Human, Avena sativa (oat))
UseGateway entry cloning vectorTags6X His and Fused with mCherryMutationRac1 starts at I4 and contains mutations Q61L, E9…Available SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCR8 PALI1
Plasmid#114442PurposeEntry vector for gateway cloning containing human PALI1 coding sequenceDepositorAvailable SinceSept. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCR8 LCOR
Plasmid#114441PurposeEntry vector for gateway cloning containing human LCOR coding sequenceDepositorAvailable SinceSept. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLCKO-CMV-ACE2-P2A-Blasticidin
Plasmid#237476PurposeEncodes full length human ACE2 protein, along with blasticidin selection marker.DepositorAvailable SinceJune 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLCKO-CMV-Blasticidin-P2A-3xHA-TMEM106B_Mouse
Plasmid#238133PurposeThis plasmid encodes the full-length Mouse (Mus musculus) TMEM106B protein fused with a 3xHA tag, along with an N-terminal blasticidin selection marker.DepositorInsertTMEM106B (Tmem106b Mouse)
UseLentiviralTagsBlasticidin-P2A-3xHAExpressionMammalianPromoterCMVAvailable SinceJune 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA2-dCas9-KRAB-TagBFP2 (identifier AAAA-0246)
Plasmid#202555PurposeSynaptotagmin-1 sgRNA2 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA3-dCas9-KRAB-TagBFP2 (Identifier AAAA-0247)
Plasmid#202556PurposeSynaptotagmin-1 sgRNA3 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only