We narrowed to 13,763 results for: sequence
-
Plasmid#154040PurposeDiatom promoter for P. tricornutum; uLoop specific syntax; AC overhangs; Lvl 0DepositorInsertPromoter SVP
UseSynthetic BiologyAvailable SinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pL0_EF_tPbt
Plasmid#154043PurposeDiatom terminator for P. tricornutum; uLoop specific syntax; EF overhangs; Lvl 0DepositorInsertTerminator Pbt
UseSynthetic BiologyAvailable SinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
p205 pCMV-cre-del
Plasmid#8393DepositorInsertdeletion
UseCre/LoxExpressionMammalianMutation1 kb EcoRI to HindIII deletion of pBS185.Available SinceAug. 4, 2006AvailabilityAcademic Institutions and Nonprofits only -
TALE5
Plasmid#35420DepositorInsertTALE5
UseLentiviralTagsEGFPExpressionMammalianPromoterEF-1aAvailable SinceMarch 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
TALE10
Plasmid#35425DepositorInsertTALE10
UseLentiviralTagsEGFPExpressionMammalianPromoterEF-1aAvailable SinceMarch 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
-
TALE12
Plasmid#35427DepositorInsertTALE12
UseLentiviralTagsEGFPExpressionMammalianPromoterEF-1aAvailable SinceMarch 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
TALE11
Plasmid#35426DepositorInsertTALE11
UseLentiviralTagsEGFPExpressionMammalianPromoterEF-1aAvailable SinceMarch 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
TALE6
Plasmid#35421DepositorInsertTALE6
UseLentiviralTagsEGFPExpressionMammalianPromoterEF-1aAvailable SinceMarch 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pUC19_TTE1564
Plasmid#61000PurposeT7-transcription template for Tte mRNA used for in vitro translationDepositorInsertTTE1564 transcript
UseUnspecifiedPromoterT7Available SinceJan. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
p201N 1509
Plasmid#55768PurposeContains soybean miRNA miR1509 recognition sequence (CAACCTTGATTTCCTTGATTAA) to produce siRNAs from 3' target sequences and induce RNA silencingDepositorTypeEmpty backboneUseRNAiPromoterGmUbiAvailable SinceSept. 8, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
pFF19H
Plasmid#49783Purposeexpresses hygromycin resistance gene in plant cellsDepositorInsertHPH
UsePlant expressionPromoterCaMV 35SAvailable SinceJuly 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
p64-101
Plasmid#25911DepositorInsertIg germline gamma-1 switch region alpha
ExpressionBacterialAvailable SinceAug. 11, 2010AvailabilityAcademic Institutions and Nonprofits only -
-
EK0720 CMV-TO-BFPmut-3UTR(t70587-long) (FLP-IN)
Plasmid#247274Purposeinactive BFP with long synthetic 3' UTRDepositorInsertBFPmut-3UTR(t70587-long)
ExpressionMammalianMutationWTPromoterCMV-TOAvailable SinceFeb. 10, 2026AvailabilityAcademic Institutions and Nonprofits only -
NSK185 SFFV-mCherry-SGc(EBER1.os13.8)cSG-EGFP-(3xMS2) (FLP-IN)
Plasmid#247280PurposemodulADAR sensor for EBER1DepositorInsertmCherry-EBER1.os13.8-EGFP
ExpressionMammalianMutationWTPromoterSFFVAvailable SinceOct. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
NSK195 SFFV-mCherry-SGc(EBER2.os13.9)cSG-EGFP-(3xMS2) (FLP-IN)
Plasmid#247281PurposemodulADAR sensor for EBER2DepositorInsertmCherry-EBER2.os13.9-EGFP
ExpressionMammalianMutationWTPromoterSFFVAvailable SinceOct. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1553
Plasmid#238470PurposepMOBC360_VL: Vector Left (VL) of the set (Chloramphenicol R) to be methylated by the M.Osp807II BsaI-associated switch methylase. Used for the assembly using the methylation protection approachDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJuly 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1554
Plasmid#238471PurposepMOBC360_VR: Vector Right (VR) of the set (Chloramphenicol R) to be methylated by the M.Osp807II BsaI-associated switch methylase. Used for the assembly using the methylation protection approachDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJune 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1358
Plasmid#236103PurposeAssembled plasmid containing four inserts (from POC1343, POC1344, POC1345 and POC1346) assembled in POC1355DepositorInsertDNA fragment flanked by BsaI sites
ExpressionBacterialAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1525
Plasmid#226496PurposepMOBC360_VM: Vector Middle (VM) of the set (Chloramphenicol R) to be methylated by the M.Osp807II BsaI-associated switch methylase. Used for the assembly using the methylation protection approachDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1551
Plasmid#226498PurposepMOBK360_StandVKL: Standard Vector (Kanamycin R) to be methylated by the M.Osp807II BsaI-associated switch methylase. Used for the assembly using the methylation protectionDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1552
Plasmid#226499PurposepMOBC360_StandVC: Standard Vector (Chloramphenicol R) to be methylated by the M.Osp807II BsaI-associated switch methylase. Used for the assembly using the methylation protectionDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1520
Plasmid#221581PurposepMOBK360_VR: Vector Right (VR) of the set (Kanamycin R) to be methylated by the M.Osp807II BsaI-associated switch methylase. Used for the assembly using the methylation protection approachDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1355
Plasmid#221572PurposeAssembly vector designed to be methylated by the M.Osp807II BsaI-associated switch methylase and for the assembly of inserts 1, 2, 3 and 4 from POC1343, POC1344, POC1345 and POC1346; respectivelyDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1430
Plasmid#221577PurposeAssembly vector designed to be methylated by the M.Osp807II BsaI-associated switch methylase and for the assembly of inserts 1, 2, 3 and 4 from POC1426, POC1427, POC1428 and POC1429; respectivelyDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1518
Plasmid#221579PurposepMOBK360_VL: Vector Left (VL) of the set (Kanamycin R) to be methylated by the M.Osp807II BsaI-associated switch methylase. Used for the assembly using the methylation protection approachDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
POC1519
Plasmid#221580PurposepMOBK360_VM: Vector Middle (VM) of the set (Kanamycin R) to be methylated by the M.Osp807II BsaI-associated switch methylase. Used for the assembly using the methylation protection approachDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJune 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCCG_nit9fl_Gephyrin_linker_reverse
Plasmid#228417PurposeExpression of NIT-9 domains in reverse orientation with Gephyrin linkage region in N. crassa at the his-3 locusDepositorInsertNIT-9 domains reversed (GPHN Human)
UseProtein expression in n. crassaMutationremoval of the linkage region and insertion of th…Available SinceApril 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCTcon2-rHUH_Y96F(G5)
Plasmid#235189PurposeTo display catalytic inactivated rHUH(G5) with Y96F mutation on yeast surfaceDepositorInsertrHUH_Y96F(G5)
ExpressionYeastAvailable SinceMarch 31, 2025AvailabilityAcademic Institutions and Nonprofits only