We narrowed to 7,699 results for: Lif;
-
Plasmid#65499PurposeFRET biosensor Destination vector for E. coli expression. Encodes a FRET pair for fusion with ligand binding domain of interest.DepositorTypeEmpty backboneTags6His-AFPt9-attR1 and attR2-mCer-cMycExpressionBacterialPromoterT7 promoterAvailable SinceJune 18, 2015AvailabilityAcademic Institutions and Nonprofits only
-
pFLIP32
Plasmid#65500PurposeFRET biosensor Destination vector for E. coli expression. Encodes a FRET pair for fusion with ligand binding domain of interest.DepositorTypeEmpty backboneTags6His-AFPt9-attR1 and attR2-t7CFPt9-cMycExpressionBacterialPromoterT7 promoterAvailable SinceJune 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFLIP39
Plasmid#65507PurposeFRET biosensor Destination vector for E. coli expression. Encodes a FRET pair for fusion with ligand binding domain of interest.DepositorTypeEmpty backboneTags6His-edAFPt9-attR1 and attR2-t7edCFPt9-cMycExpressionBacterialPromoterT7 promoterAvailable SinceJune 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDonr201_PARG WT
Plasmid#240315PurposeEntry vector for Gateway with PARGDepositorInsertPARG (PARG Human)
ExpressionBacterialAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJFT7_nHalo_DC(r4)_PARG_Mutation
Plasmid#240316PurposeGateway compatible vector expressing PARG (E755/756A)DepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
VEE-moxBFP-IRES-PuroR
Plasmid#242413PurposeSpectral unmixing: moxBFP onlyDepositorInsertsmoxBFP
IRES-PuroR
UseSelf-amplifying rnaExpressionMammalianAvailable SinceSept. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
VEE-mScarlet3-IRES-PuroR
Plasmid#242415PurposeSpectral unmixing: mScarlet3 onlyDepositorInsertsmScarlet3
IRES-PuroR
UseSelf-amplifying rnaExpressionMammalianAvailable SinceSept. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
RNF168 C-terminal sgRNA
Plasmid#207100PurposepX330 based plasmid for expression of Cas9 and the GAGATGCACAAAGTAAGGCC sgRNA to target the RNF168 locus.DepositorInsertGAGATGCACAAAGTAAGGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
RIF C-terminal sgRNA
Plasmid#207096PurposepX330 based plasmid for expression of Cas9 and the AATACTAAATAGAATTTTCA sgRNA to target the RIF1 locus.DepositorInsertAATACTAAATAGAATTTTCA
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6-BoxB-petracrRNA
Plasmid#207625PurposeExpresses BoxB-petracrRNA in mammalian cells (with a human-U6 promoter)DepositorInsertBoxB-petracrRNA
UseSynthetic BiologyPromoterhU6Available SinceFeb. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAM198
Plasmid#227657PurposepRS305 His-HRV3C-Rpn5 WTDepositorAvailable SinceDec. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAM200
Plasmid#227659PurposepRS305 3XFLAG-HRV3C-Rpn5 WTDepositorAvailable SinceDec. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
pDestTol2-QUAS:GFP-CAAX-he1.1:YFP
Plasmid#184816PurposeUsed to generate the Tg(QUAS:GFP-CAAX; he1.1:YFP)c631 transgenic lineDepositorInsertQUAS:GFP-CAAX-pA; he1.1:CFP
UseZebrafish tol2 transgenesisTagsGFP-CAAXAvailable SinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDR274-gsc2-sgRNA
Plasmid#184818PurposeUsed to synthesize gRNA targeting exon 2 of the gsc2 geneDepositorInsertgsc2-sgRNA
UseCRISPR; Template for sgrna synthesisAvailable SinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
-
pDestTol2-QUAS:NLS-mApple-he1.1:CFP
Plasmid#184814PurposeUsed to generate the Tg(QUAS:NLS-mApple; he1.1:CFP)c718 transgenic lineDepositorInsertQUAS:NLS-mApple-pA; he1.1:CFP
UseZebrafish tol2 transgenesisTagsNLS-mAppleAvailable SinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDestTol2-QUAS:NLS-GFP-he1.1:CFP
Plasmid#184815PurposeUsed to generate the Tg(QUAS:NLS-GFP; he1.1:CFP)c682 transgenic lineDepositorInsertQUAS:NLS-GFP-pA; he1.1:CFP
UseZebrafish tol2 transgenesisTagsNLS-GFPAvailable SinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 N-terminal sgRNA
Plasmid#207094PurposepX330 based plasmid for expression of Cas9 and the TTACTGCAGAATGACTACAG sgRNA to target the SHLD3 locus.DepositorInsertTTACTGCAGAATGACTACAG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
NBS1 C-terminal sgRNA
Plasmid#207092PurposepX330 based plasmid for expression of Cas9 and the TAAAAAGGAGAAGATAACTG sgRNA to target the NBS1 locus.DepositorInsertTAAAAAGGAGAAGATAACTG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF169 C-terminal sgRNA
Plasmid#207099PurposepX330 based plasmid for expression of Cas9 and the ACACTTCATTAGGTGCTACT sgRNA to target the RNF169 locus.DepositorInsertACACTTCATTAGGTGCTACT
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD1 N-terminal sgRNA
Plasmid#207101PurposepX330 based plasmid for expression of Cas9 and the ATGGCAGGACTATGGCAGCC sgRNA to target the SHLD1 locus.DepositorInsertATGGCAGGACTATGGCAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM C-terminal sgRNA
Plasmid#207097PurposepX330 based plasmid for expression of Cas9 and the TTTCTAAAGGCTGAATGAAA sgRNA to target the ATM locus.DepositorInsertTTTCTAAAGGCTGAATGAAA
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #1
Plasmid#207105PurposepX330 based plasmid for expression of Cas9 and the CGCTATCAAGATTTATACCT sgRNA to target the SHLD3 locus..DepositorInsertCGCTATCAAGATTTATACCT
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD2 N-terminal sgRNA
Plasmid#207098PurposepX330 based plasmid for expression of Cas9 and the TTTTTATCAGAAATCATGAG sgRNA to target the SHLD2 locus.DepositorInsertTTTTTATCAGAAATCATGAG
ExpressionMammalianPromoterCMV and U6Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
HaloTag KO sgRNA
Plasmid#207102PurposepX330 based plasmid for expression of Cas9 and the GTCGATGTTGGTCCGCGCGA sgRNA to target the HaloTag coding sequence.DepositorInsertGTCGATGTTGGTCCGCGCGA
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
MDC1 N-terminal sgRNA
Plasmid#207090PurposepX330 based plasmid for expression of Cas9 and the GTATCCTTCCCAGATCATGG sgRNA to target the MDC1 locus.DepositorInsertGTATCCTTCCCAGATCATGG
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #2
Plasmid#207106PurposepX330 based plasmid for expression of Cas9 and the CTGAAGGAACAGACTAATTC sgRNA to target the SHLD3 locus..DepositorInsertCTGAAGGAACAGACTAATTC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
53BP1 KO sgRNA
Plasmid#207104PurposepX330 based plasmid for expression of Cas9 and the AGATTCTCAGCCTGAAAGCC sgRNA to target the 53BP1 coding sequence.DepositorInsertAGATTCTCAGCCTGAAAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX459-canis_PTGS2-4
Plasmid#184730PurposeCOX2-KO in MDCKDepositorInsertA gRNA targeting the dog COX2 gene.
UseCRISPRAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX459-homo_PLA2G4A-1
Plasmid#184735PurposecPLA2-KO in HeLaDepositorInsertA gRNA targeting the human cPLA2 gene.
UseCRISPRAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX459-homo_PLA2G4A-2
Plasmid#184736PurposecPLA2-KO in HeLaDepositorInsertA gRNA targeting the human cPLA2 gene.
UseCRISPRAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPBbsr2-OptoSTIM1(CRY2clust)
Plasmid#184715PurposeOptoSTIM1(CRY2clust)DepositorInsertOptoSTIM1
ExpressionMammalianAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPBbsr2-EBFP2-OptoSTIM1(CRY2clust)
Plasmid#184716PurposeOptoSTIM1(CRY2clust)DepositorInsertOptoSTIM1
ExpressionMammalianAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPBbsr2-PTGER2
Plasmid#184721PurposeExogenous EP2DepositorInsertPTGER2 (PTGER2 Synthetic, Human)
ExpressionMammalianAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-bleo-COX1-4
Plasmid#184722PurposeCOX1-KO in MDCKDepositorInsertA gRNA targeting the dog COX1 gene.
UseCRISPR and LentiviralAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-hyg2-COX2-4
Plasmid#184723PurposeCOX2-KO in MDCKDepositorInsertA gRNA targeting the dog COX2 gene.
UseCRISPR and LentiviralAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-bleo-PTGER2
Plasmid#184724PurposeEP2-KO in MDCKDepositorInsertA gRNA targeting the dog EP2 gene.
UseCRISPR and LentiviralAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-bleo-PLA2G4A_3
Plasmid#184725PurposecPLA2-KO in MDCKDepositorInsertA gRNA targeting the dog cPLA2 gene.
UseCRISPR and LentiviralAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-hyg2-PTGER4
Plasmid#184726PurposeEP4-KO in MDCKDepositorInsertA gRNA targeting the dog EP4 gene.
UseCRISPR and LentiviralAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX459-canis_PTGS1-3
Plasmid#184727PurposeCOX1-KO in MDCKDepositorInsertA gRNA targeting the dog COX1 gene.
UseCRISPRAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX459-canis_PTGS1-4
Plasmid#184728PurposeCOX1-KO in MDCKDepositorInsertA gRNA targeting the dog COX1 gene.
UseCRISPRAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX459-canis_PTGS2-3
Plasmid#184729PurposeCOX2-KO in MDCKDepositorInsertA gRNA targeting the dog COX2 gene.
UseCRISPRAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPBpuro-UbC-4493NES(Booster-PKA)
Plasmid#184711PurposePKA biosensorDepositorInsertBooster-PKA
ExpressionMammalianAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCSIIhyg-iRFP670-P2Av3-RGECO1.0
Plasmid#184713PurposeCalcium biosensorDepositorInsertGCaMP6s
UseLentiviralExpressionMammalianAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBbA5k-AcrAB-AsLOV2*(543)
Plasmid#210863PurposeIPTG inducible promoter (lacUV5) expressing AcrA and AcrB-AsLOV2*(543). AsLOV2*(543) is also described in the literature as LOVdeg.DepositorInsertsacrA
acrB
UseSynthetic BiologyTagsAsLOV2*(543)Available SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-pOTC-GFP
Plasmid#205724PurposeExpression of GFP fused with pOTC, a leader peptide from mitochondrial matrix enzyme ornithine transcarbamylaseDepositorInsertpOTC-GFP
ExpressionMammalianAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
TaraACR1-pmCherry-C1
Plasmid#204960PurposeExpression of TaraACR1 in fusion with mCherry in mammalian cellsDepositorInsertTaraACR1
TagsmCherryExpressionMammalianPromoterCMV (+ enhancer)Available SinceOct. 25, 2023AvailabilityAcademic Institutions and Nonprofits only