We narrowed to 15,988 results for: grna
-
Plasmid#196847Purposebackbone for gRNA cloning of dpspCas13b tagged by 1xMS2DepositorTypeEmpty backboneUseCRISPRAvailable SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only
-
gRNA-CasRx_SD1-pSV40-TagBFP
Plasmid#221004PurposeTransiently express CasRx DR30 repeat with gRNA spacer. Contains SD1 mutation to enhance efficiency. SV40-TagBFP cassette to monitor transfection efficiency. Use BbsI with overhangs Fw-AAAC, Rv-AAAA.DepositorInsertCasRx 30nt processed direct repeat with SD1 mutation
UseCRISPRExpressionMammalianMutationDR1 A>TPromoterU6Available SinceJune 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(gBFP)-PGKmCherry2ABFP-W
Plasmid#67986PurposeCas9 activity reporter with mCherry and BFPDepositorInsertsU6gRNA cassette, PGKmCherryABFP cassette, WPRE
Guide RNA targeting modified BFP
UseCRISPR and LentiviralMutationDeleted BbsI site within WPRE, modified BFPAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCAG-eCas9-GFP-U6-gRNA
Plasmid#79145PurposeAll-in-one CRISPR/Cas9 vector with high-fidelity eSpCas9 expression in human pluripotent stem cellsDepositorInserteSpCas9(1.1)
UseCRISPRTags2A-GFPExpressionMammalianPromoterCAGAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-sgRNA-CMV-GFP
Plasmid#85451PurposeExpress sgRNA in mammalian cellsDepositorInsertpCMV-EGFP
UseAAVPromoterpCMV-EGFPAvailable SinceJan. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
sgRNA(MS2) cloning backbone
Plasmid#61424PurposesgRNA cloning backbone with MS2 loops at tetraloop and stemloop 2. Contains BbsI sites for insertion of spacer sequences.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6Available SinceDec. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-U6sgRNA(BbsI)-PGKpuro2ABFP
Plasmid#102796PurposeRetrovirus for delivery of one sgRNA (empty, bbsI)DepositorInsertU6 sgRNA
UseCRISPR and RetroviralExpressionMammalianPromoterU6Available SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLV sgRNA-Notch1 #1 GFP
Plasmid#106950PurposeLentivirus encoding sgRNA targeting murine Notch1. Includes GFP marker.DepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV sgRNA-Hic1 GFP
Plasmid#106953PurposeLentivirus encoding sgRNA targeting murine Hic1. Includes GFP marker.DepositorInsertanti-Hic1 sgRNA
UseCRISPR and LentiviralExpressionMammalianAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA as2
Plasmid#132394PurposeTargets AAVS1 intron 1, gRNA: AGAACCAGAGCCACATTAAC, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pU6-PspCas13b-gRNA-Actb1216
Plasmid#155368PurposePspCas13b guide RNA positioned 8bp 5' of Actb 1216 for targeted m6A RNA methylationDepositorInsertPspCas13b gRNA targeting Actb 1216
UseCRISPRExpressionMammalianAvailable SinceJuly 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUF-Cas9-pre-sgRNA
Plasmid#137845PurposeCas9 and gRNA expression plasmid for P. falciparum with yDHODH selectable marker.DepositorTypeEmpty backboneUseCRISPRAvailable SinceMay 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 pegRNA1 with trimmed attP
Plasmid#222346PurposepegRNA 1 plasmid used for PASSIGE-mediated Bxb1 attP installationDepositorInsertAAVS1 attP-installation pegRNA1
UseCRISPRAvailable SinceJune 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 pegRNA2 with trimmed attP
Plasmid#222347PurposepegRNA 2 plasmid used for PASSIGE-mediated Bxb1 attP installationDepositorInsertAAVS1 attP-installation pegRNA2
UseCRISPRAvailable SinceJune 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS79 (eft-3p::Cas9 + sgRNA)
Plasmid#154839PurposeCas9 + sgRNA plasmid that is targeted to the synthetic guide sequence GGACAGTCCTGCCGAGGTGGDepositorInsertsgRNA
UseCRISPRExpressionWormAvailable SinceAug. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPB_mU6_enh-gRNA_Puro-T2A-BFP
Plasmid#235571PurposeEnhanced guide RNA expression & genomic integration. Target gRNA sequences are cloned in via the BstXI and BlpI sites.DepositorInsertsgRNA backbone
UseCRISPRAvailable SinceApril 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-U6-epegRNA-SV40-puro
Plasmid#240539PurposeLentiviral backbone plasmid to insert epegRNAs (tevopreq1) of interest with puromycin resistance. The cloning site is BsmBI.DepositorInsertepegRNA
UseCRISPR and LentiviralExpressionMammalianAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(RUNX1T1 g3)-PGKpuroBFP-W
Plasmid#211984PurposeExpress gRNA against RUNX1T1 with puro and BFPDepositorInsertsgRNA targeting RUNX1T1 (RUNX1T1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(RUNX1T1 g7-5)-PGKpuroBFP-W
Plasmid#211985PurposeExpress gRNA against RUNX1T1 with puro and BFPDepositorInsertsgRNA targeting RUNX1T1 (RUNX1T1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPR-v2 Puro EIF2AK4/GCN2_sgRNA
Plasmid#218528PurposesgRNA targeting human EIF2AK4/GCN2DepositorInsertEIF2AK4 (EIF2AK4 Human)
UseCRISPR and LentiviralAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only