We narrowed to 4,761 results for: IRES
-
Plasmid#241928PurposeExpresses a GNAQ guide RNA resistant LAMP1-GNAQ Q209P L43A/L44A mutant fusion proteinDepositorInsertLAMP1-GNAQ Q209P L43A/L44A sgRES (GNAQ Human)
UseLentiviralExpressionMammalianMutationQ209P, L43A/L44AAvailable sinceJuly 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
str-KDEL_Stx5L(M55V)-SBP-mCitrine
Plasmid#209846PurposeSynchronize trafficking of Stx5L (M55V) from the ER, for use with FLIM (RUSH system)DepositorInsertSTX5 (STX5 Human)
TagsStreptavidin Binding Protein (SBP) and mCitrineExpressionMammalianMutationChanged Methionine 55 to Valine, causes loss of S…PromoterCMVAvailable sinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
str-KDEL_Stx5S-SBP-mCitrine
Plasmid#154845PurposeSynchronize trafficking of Stx5S from the ER, for use with FLIM (RUSH system)DepositorInsertStx5 (Short isoform) (STX5 Human)
TagsStreptavidin Binding Protein (SBP) and mCitrineExpressionMammalianMutationLacks amino acids 1-54, enocdes short isoform of …PromoterCMVAvailable sinceNov. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUC18 Apln5-HA-FlpO-pA-LoxP-PGK-Neo-pA-LoxP-Apln3 (SO89)
Plasmid#159222PurposeCan be used to target the mouse Apln locus in mouse eggs or ES cells, in order to drive the mosaic expression of the protein HA-NLS-FlpODepositorInsertApln 5'-FlpO-WPRE-Sv40pA-LoxP-PGK-Neo-pA-LoxP-Apln
ExpressionMammalianPromoterAplnAvailable sinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGEX-2TK-WW-CR-W3083F
Plasmid#18076DepositorInsertDystrophin (DMD Human)
TagsGSTExpressionBacterialMutationSecond conserved Tryptophan (W) of the WW domain …Available sinceMay 29, 2008AvailabilityAcademic Institutions and Nonprofits only -
pGEX-2TK-WW-CR-d-ZZ-W3083F
Plasmid#18078DepositorInsertDystrophin (DMD Human)
TagsGSTExpressionBacterialMutationSecond conserved Tryptophan (W) of the WW domain …Available sinceMay 29, 2008AvailabilityAcademic Institutions and Nonprofits only -
pDEST-Myc-FBW7K404/412/R
Plasmid#200716PurposeThe plasmid expresses Myc-tagged FBW7 human isoform 1 with Lys404 & 412 to Arg mutation. Used for mammalian overexpression and detection by western blotting.DepositorInsertFBW7 (FBXW7 Human)
TagsMycExpressionMammalianMutationFBW7 K404 and K412 mutated to Alanines.PromoterCMVAvailable sinceJune 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEX-5X-3-GST-DmGW182_1-593_F
Plasmid#146271PurposeBacterial Expression of DmGW182_1-593DepositorInsertDmGW182_1-593 (gw Fly)
ExpressionBacterialMutationone non silent mutation T1772A (L591Q) compared t…Available sinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV_pMBP-dnVamp3-P2AT2A-EGFP-caax
Plasmid#190154PurposeExpresses dominant-negative Vamp3 (rat Vamp3 AA 1-81) plus membrane-targeted EGFP in oligodendrocytes; AAV vectorDepositorInsertVamp3 (Vamp2 Rat)
UseAAVTagsP2AT2A-EGFP-caaxExpressionMammalianMutationTruncation that includes only rat Vamp3 AA #1-81PromoterMBPAvailable sinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmAGO1-RB_B
Plasmid#145977PurposeInsect Expression of DmAGO1-RBDepositorInsertDmAGO1-RB (AGO1 Fly)
ExpressionInsectAvailable sinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUASp-Flag-Myc-Qin-Tudor-attB
Plasmid#44210DepositorInsertQin-Tudor-domain (qin Fly)
UseFly transformationTagsFlag and MycMutationlacks E3 domain on N-term (del aa1-274)Available sinceOct. 31, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDEST-Myc-FBW7 Delta WD40 (-2 to 7)
Plasmid#197454PurposeThe plasmid expresses delta WD40 deleted version of Myc-tagged FBW7 human isoform 1. WD40 propellars 2 to 7 are deleted. Used for mammalian overexpression and detection by western blotting.DepositorInsertFBW7 Delta-WD40 propeller (FBXW7 Human)
TagsMycExpressionMammalianMutationFBW& dimerization domain deleted.PromoterCMVAvailable sinceJune 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX458-Ef1a-Cas9-H2B-mCherry (dual gRNA: Ascl1 x2)
Plasmid#171099PurposeCRISPR/Cas9 expressing plasmid containing two gRNAs targeting mouse Ascl1.DepositorAvailable sinceJune 28, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pcDNA4-rB90
Plasmid#18959DepositorInsertBrevican C-terminus (Bcan Rat)
ExpressionMammalianMutationRat brevican C-terminus: Signal peptide aa 1-22 …Available sinceDec. 12, 2008AvailabilityAcademic Institutions and Nonprofits only -
pGEX-2TK-WW-CR-W3083F/P3086A
Plasmid#18077DepositorInsertDystrophin (DMD Human)
TagsGSTExpressionBacterialMutationSecond conserved Tryptophan (W) of the WW domain …Available sinceMay 29, 2008AvailabilityAcademic Institutions and Nonprofits only -
pGEX-2TK-WW-CR-d-ZZ-W3083F/P3086A
Plasmid#18079DepositorInsertDystrophin (DMD Human)
TagsGSTExpressionBacterialMutationSecond conserved Tryptophan (W) of the WW domain …Available sinceMay 29, 2008AvailabilityAcademic Institutions and Nonprofits only -
pLV-PB2_Lock1-I436C+S993C
Plasmid#182879PurposeLentivirus for expression of Plexin-B2 locked ring mutantDepositorInserthPLXNB2 (PLXNB2 Human)
UseLentiviralMutationchanged Isoleucine 436 to Cysteine and Serine 993…Available sinceJan. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-PB2_Lock2-I436C+T1051C
Plasmid#182880PurposeLentivirus for expression of Plexin-B2 locked ring mutantDepositorInserthPLXNB2 (PLXNB2 Human)
UseLentiviralMutationchanged Isoleucine 436 to Cysteine and Threonine …Available sinceJan. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA2-dCas9-KRAB-TagBFP2 (identifier AAAA-0246)
Plasmid#202555PurposeSynaptotagmin-1 sgRNA2 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA3-dCas9-KRAB-TagBFP2 (Identifier AAAA-0247)
Plasmid#202556PurposeSynaptotagmin-1 sgRNA3 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only