We narrowed to 15,732 results for: grna
-
Plasmid#213054PurposeModular Unit carrying pegRNA and ngRNA scaffolds flanked by attL5 and attR3DepositorInsertsgRNA
UseTagsExpressionBacterialMutationPromoterAvailable sinceFeb. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY0207 ACTB atgRNA with v1 scaffold
Plasmid#179107PurposeACTB N-term PBS 13 RT 29 Bxb1 AttB 46 atgRNADepositorInsertACTB N-term PBS 13 RT 29 AttB 46 atgRNA
UseCRISPRTagsExpressionMutationPromoterAvailable sinceFeb. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
hU6-pegRNA-EF-1α-Cre Template
Plasmid#196036PurposeThe template UPEC vector designed for cloning of a single pegRNA and subsequent co-expression with Cre.DepositorTypeEmpty backboneUseTagsExpressionMammalianMutationPromoterhU6 and EF-1-alphaAvailable sinceJune 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti SpBsmBI sgRNA Puro
Plasmid#62207PurposeAn empty sgRNA expression vector for expression of sgRNA for Sp Cas9 (3rd generation lentiviral vector)DepositorTypeEmpty backboneUseLentiviralTagsExpressionMammalianMutationPromoterU6Available sinceMay 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX330 Mouse 3' Hp1a gRNA
Plasmid#127898PurposeWT Cas9 Vector targeting the 3' end of the mouse Hp1a geneDepositorInsertgRNA/Cas9
UseCRISPRTagsExpressionMutationPromoterAvailable sinceSept. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLH-sgRNA-Sirius-8XPP7
Plasmid#121940PurposeCRISPR-Sirius plasmidDepositorInsertsgRNA-Sirius-8XPP7
UseCRISPR and LentiviralTagsnoExpressionMammalianMutationPromoterhuman U6 promoterAvailable sinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(LIN28A_5-4)-PGKpuroBFP-W
Plasmid#211969PurposeExpress gRNA against LIN28A with puro and BFPDepositorInsertsgRNA targeting LIN28A (LIN28A Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterHuman U6 promoterAvailable sinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(LIN28A_5-3)-PGKpuroBFP-W
Plasmid#211968PurposeExpress gRNA against LIN28A with puro and BFPDepositorInsertsgRNA targeting LIN28A (LIN28A Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterHuman U6 promoterAvailable sinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pU6-sp-sgRNA-mDNMT1_nick-lenti
Plasmid#135959PurposeS. pyogenes nicking sgRNA for mouse DNMT1DepositorInsertmDNMT1_nick
UseTagsExpressionMammalianMutationSee manuscriptPromoterU6Available sinceJan. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNLuc
Plasmid#208382PurposeDerived from LentiCRISPRV2 by replacing Cas9 with Cre recombinase and puromycin resistance with GpNLuc. Contains a stuffer sequence for cloning of sgRNA of interest, as per LentiCRISPRV2.DepositorTypeEmpty backboneUseLentiviral and LuciferaseTagsExpressionMammalianMutationWTPromoterAvailable sinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
CaTCH Dual-sgRNA_sgBC1-A_sgBC1-C
Plasmid#154196PurposeLentiviral expression plasmid encoding two sgRNAs for targeting of the CaTCH barcode cassette BC1. Expresses Thy1.1 and a Neo selection marker.DepositorInsertsgRNA-BC1-A, sgRNA-BC1-C
UseLentiviral; Catch barcode activationTagsExpressionMammalianMutationPromoterhU6 and mU6Available sinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
DNA-PKcs N-terminal sgRNA
Plasmid#207093PurposepX330 based plasmid for expression of Cas9 and the AGCGGGACTCGGCGGCATGG sgRNA to target the DNA-PKcs locus.DepositorInsertAGCGGGACTCGGCGGCATGG
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
Icam 2 SaCas9 YAP sgRNA2
Plasmid#99735PurposeExpresses SaCas9 and a gRNA targeting mouse YAPDepositorInsertSaCas9 gRNA targeting Yap1 (Yap1 Mouse)
UseAAV and CRISPRTagsExpressionMammalianMutationPromoterU6Available sinceDec. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSB700 lenti gRNA mcherry
Plasmid#167910PurposeLentiviral vector for expressing U6 sgRNA cloning plasmidDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceSept. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SMVP-Cas9N-U6-gRNA M3
Plasmid#80936PurposeExpresses Cas9N in mammalian cells; expresses gRNA M3 for Mstn cleavage.DepositorInsertCas9N
UseAAV, CRISPR, and Synthetic BiologyTagsExpressionMammalianMutationPromoterAvailable sinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCR8-attR4-pegRNA-attR3
Plasmid#213056PurposeModular Unit carrying pegRNA and ngRNA scaffolds flanked by attR4 and attR3DepositorInsertsgRNA
UseTagsExpressionBacterialMutationPromoter35S-CmYCLV-AtU6Available sinceFeb. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCR8-attL5-pegRNA-attL4
Plasmid#213055PurposeModular Unit carrying pegRNA and ngRNA scaffolds flanked by attL5 and attL4DepositorInsertsgRNA
UseTagsExpressionBacterialMutationPromoter35S-CmYCLV-AtU6Available sinceFeb. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCR8-attL1-pegRNA-attR5
Plasmid#213053PurposeModular Unit carrying pegRNA and ngRNA scaffolds flanked by attL1 and attR5DepositorInsertsgRNA
UseTagsExpressionBacterialMutationPromoter35S-CmYCLV-AtU6Available sinceFeb. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV-U6gRNA-EF(BbsI)-PGKpuro2ABFP
Plasmid#62348PurposeAn empty optimized gRNA expression vectorDepositorInsertnone
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJune 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-DNMT3A-PuroR_BACH2-sgRNA8
Plasmid#71828PurposeExpression of dCas9-DNMT3A fusion with T2A-PuroR and specific sgRNA for targeted DNA methylation of BACH2 promoter in human cells; for use as a controlDepositorInsertBACH2-sgRNA8 (BACH2 Synthetic, Human, S. pyogenes)
UseCRISPRTags3xFLAG, SV40 NLS, and T2A-PuroRExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9PromoterU6Available sinceMarch 7, 2016AvailabilityAcademic Institutions and Nonprofits only