We narrowed to 362 results for: gag pol
-
Plasmid#180398PurposeProducing AAV that encodes mouse Irak1 shRNA-2 with miR-E backboneDepositorInsertshIrak1-2 (Irak1 Mouse)
UseAAV and RNAiTagsExpressionMutationPromoterCBAAvailable sinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
tet-pLKO.puro_shHuR CDS
Plasmid#110411PurposeTRCN0000276129 (Target CGAGCTCAGAGGTGATCAAAG), silence human ELAVL1 (HuR) gene, doxycycline inducible, puromycin selectionDepositorInsertELAVL1 (HuR)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterH1/TO (RNA PolIII)Available sinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUC57-ITR2-H1-GFP sgRNA Target 4- eCMV- S.pyoegenes-3XFLAG-SV40NLS-ITR2
Plasmid#210740PurposeCoding for Sp Cas9 alongside Sp sgRNA targeting GFP Target 4DepositorInsertsUseCRISPRTags3xFLAG, SV40 NLS, PolyA signalExpressionMammalianMutationPromoterH1 and eCMVAvailable sinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCL.175
Plasmid#184996PurposeExpress -Eco1 HEK3 editing ncRNA and gRNADepositorInsertEco1: HEK3 targeting and editing ncRNA-gRNA (a1/a2 length: 27 v1), expressed constitutively from a pol III (H1) promoter
UseTagsSV40NLSExpressionMammalianMutationHEK3 donor, a1/a2 length extended for 27 bpPromoterH1Available sinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.179
Plasmid#185000PurposeExpress -Eco1 HEK4 editing ncRNA and gRNADepositorInsertEco1: HEK4 targeting and editing ncRNA-gRNA (a1/a2 length: 27 v1), expressed constitutively from a pol III (H1) promoter
UseTagsSV40NLSExpressionMammalianMutationHEK4 donor, a1/a2 length extended for 27 bpPromoterH1Available sinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfb13220
Plasmid#219895PurposeThe base plasmid of TUNEYALI for TF30DepositorInsertContains gRNA targeting TF30 (YALI1_D10007g) and homologous arm matching TF30
UseTagsExpressionYeastMutationPromoterAvailable sinceJuly 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfb13197
Plasmid#219872PurposeThe base plasmid of TUNEYALI forTF07DepositorInsertContains gRNA targeting TF07 ( YALI1_D30097g) and homologous arm matching TF07
UseTagsExpressionYeastMutationPromoterAvailable sinceJune 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfb13226
Plasmid#219901PurposeThe base plasmid of TUNEYALI for TF36DepositorInsertContains gRNA targeting TF36 (YALI1_A22330g) and homologous arm matching TF36
UseTagsExpressionYeastMutationPromoterAvailable sinceJune 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfb13208
Plasmid#219883PurposeThe base plasmid of TUNEYALI for TF18DepositorInsertContains gRNA targeting TF18 (YALI1_D15792g) and homologous arm matching TF18
UseTagsExpressionYeastMutationPromoterAvailable sinceJune 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCfb13195
Plasmid#219870PurposeThe base plasmid of TUNEYALI forTF05DepositorInsertContains gRNA targeting TF05 (YALI1_D02362g) and homologous arm matching TF05
UseTagsExpressionYeastMutationPromoterAvailable sinceJune 5, 2024AvailabilityAcademic Institutions and Nonprofits only