We narrowed to 890 results for: Px330
-
Plasmid#227326PurposeDonor template for mStayGold insertion into the N-terminus of the ACTB locus. For actin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-ACTB (Addgene #207748)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertACTB Homology Arms flanking a mStayGold Tag (ACTB Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable sinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-LAMP1
Plasmid#227322PurposeDonor template for mStayGold insertion into the C-terminus of the LAMP1 locus. For lysosome visualization. To be co-transfected with sgRNA plasmid px330-LAMP1 (Addgene #207787)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertLAMP1 Homology Arms flanking a mStayGold Tag (LAMP1 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable sinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC CBA-SpCas9.EF1a-BFP.sgLMNA
Plasmid#98971PurposeCas9 Homologous Recombination Reporter. SpCas9 and a sgRNA targeting LMNA. TagBFP.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertLMNA sgRNA and spCas9
ExpressionMammalianAvailable sinceDec. 11, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
ExpressionMammalianPromoterCMV and U6Available sinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 N-terminal sgRNA
Plasmid#207094PurposepX330 based plasmid for expression of Cas9 and the TTACTGCAGAATGACTACAG sgRNA to target the SHLD3 locus.DepositorInsertTTACTGCAGAATGACTACAG
ExpressionMammalianPromoterCMV and U6Available sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF169 C-terminal sgRNA
Plasmid#207099PurposepX330 based plasmid for expression of Cas9 and the ACACTTCATTAGGTGCTACT sgRNA to target the RNF169 locus.DepositorInsertACACTTCATTAGGTGCTACT
ExpressionMammalianPromoterCMV and U6Available sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD1 N-terminal sgRNA
Plasmid#207101PurposepX330 based plasmid for expression of Cas9 and the ATGGCAGGACTATGGCAGCC sgRNA to target the SHLD1 locus.DepositorInsertATGGCAGGACTATGGCAGCC
ExpressionMammalianPromoterCMV and U6Available sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM C-terminal sgRNA
Plasmid#207097PurposepX330 based plasmid for expression of Cas9 and the TTTCTAAAGGCTGAATGAAA sgRNA to target the ATM locus.DepositorInsertTTTCTAAAGGCTGAATGAAA
ExpressionMammalianPromoterCMV and U6Available sinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #1
Plasmid#207105PurposepX330 based plasmid for expression of Cas9 and the CGCTATCAAGATTTATACCT sgRNA to target the SHLD3 locus..DepositorInsertCGCTATCAAGATTTATACCT
ExpressionMammalianPromoterCMV and U6Available sinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATG13 sgRNA
Plasmid#207558PurposepX330 expressing Cas9 and a sgRNA targeting the ATG13 locusDepositorInsertggaaactgatctcaattccc
ExpressionMammalianPromoterCMV and U6Available sinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD2 N-terminal sgRNA
Plasmid#207098PurposepX330 based plasmid for expression of Cas9 and the TTTTTATCAGAAATCATGAG sgRNA to target the SHLD2 locus.DepositorInsertTTTTTATCAGAAATCATGAG
ExpressionMammalianPromoterCMV and U6Available sinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
HaloTag KO sgRNA
Plasmid#207102PurposepX330 based plasmid for expression of Cas9 and the GTCGATGTTGGTCCGCGCGA sgRNA to target the HaloTag coding sequence.DepositorInsertGTCGATGTTGGTCCGCGCGA
ExpressionMammalianPromoterCMV and U6Available sinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
MDC1 N-terminal sgRNA
Plasmid#207090PurposepX330 based plasmid for expression of Cas9 and the GTATCCTTCCCAGATCATGG sgRNA to target the MDC1 locus.DepositorInsertGTATCCTTCCCAGATCATGG
ExpressionMammalianPromoterCMV and U6Available sinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #2
Plasmid#207106PurposepX330 based plasmid for expression of Cas9 and the CTGAAGGAACAGACTAATTC sgRNA to target the SHLD3 locus..DepositorInsertCTGAAGGAACAGACTAATTC
ExpressionMammalianPromoterCMV and U6Available sinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Puro-mStayGold-LMNB1
Plasmid#227329PurposeDonor template for Puro-2A-mStayGold insertion into the N-terminus of the LMNB1 locus. For nuclear envelope visualization. To be co-transfected with sgRNA plasmid px330-PITCh-LMNB1 (Addgene #207770)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertLMNB1 Homology Arms flanking a Puro-2A-mStayGold (LMNB1 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable sinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-mNeon-Puro-TOMM20
Plasmid#207790PurposeDonor template for mNeon-2A-Puro insertion into the C-terminus of the TOMM20 locus. For mitochondria visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TOMM20 (Addgene #207789)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTOMM20 Homology Arms flanking a mNeon-Puro Cassette (TOMM20 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable sinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-moxGFP-Puro-H2BC11
Plasmid#207758PurposeDonor template for moxGFP-2A-Puro insertion into the C-terminus of the H2BC11 locus for nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H2BC11 Addgene #207755DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertH2BC11 Homology Arms flanking a moxGFP-Puro Cassette (H2BC11 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable sinceNov. 17, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
ER50-SpCas9-ER50
Plasmid#85448PurposeExpresses SpCas9 fused to ER50 domain on both N- and C-termini in mammalian cellsDepositorInsertER50-SpCas9-ER50
UseAAVTagsdestabilized domain of estrogen receptor ligand b…ExpressionMammalianPromoterCbhAvailable sinceFeb. 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
FUG-T2A-Cas9
Plasmid#75346PurposeUbiquitin promoter expresses GFP and humanized spCas9 (from PX330) via a T2A motif. For cell transfection or use in lentiviral packaging. Use Pac1 and/or BstB1 sites to insert sgRNAs from PXL.DepositorInsertCas9
UseCRISPR and LentiviralTagsGFP (via t2a)ExpressionMammalianPromoterUbiquitinAvailable sinceMay 20, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
qTAG-N-Solo-mStayGold-TJP1
Plasmid#227300PurposeDonor template for mStayGold insertion into the N-terminus of the TJP1 locus. For tight junction visualization. To be co-transfected with sgRNA plasmid px330-TJP1 (Addgene #227299)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTJP1 Homology Arms flanking a mStayGold Tag (TJP1 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable sinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only