We narrowed to 889 results for: Px330
-
Plasmid#227275PurposeAAVS1 targeting donor for the insertion of Puro and a medium strength PGK expressing moxGFP. To be co-transfected with sgRNA plasmid px330-AAVS1 (Addgene #227272)DepositorInsertAAVS1 Homology Arms flanking a 2A-Puro-PGK-moxGFP cassette (AAVS1 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 N-terminal sgRNA
Plasmid#207094PurposepX330 based plasmid for expression of Cas9 and the TTACTGCAGAATGACTACAG sgRNA to target the SHLD3 locus.DepositorInsertTTACTGCAGAATGACTACAG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
NBS1 C-terminal sgRNA
Plasmid#207092PurposepX330 based plasmid for expression of Cas9 and the TAAAAAGGAGAAGATAACTG sgRNA to target the NBS1 locus.DepositorInsertTAAAAAGGAGAAGATAACTG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF169 C-terminal sgRNA
Plasmid#207099PurposepX330 based plasmid for expression of Cas9 and the ACACTTCATTAGGTGCTACT sgRNA to target the RNF169 locus.DepositorInsertACACTTCATTAGGTGCTACT
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD1 N-terminal sgRNA
Plasmid#207101PurposepX330 based plasmid for expression of Cas9 and the ATGGCAGGACTATGGCAGCC sgRNA to target the SHLD1 locus.DepositorInsertATGGCAGGACTATGGCAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM C-terminal sgRNA
Plasmid#207097PurposepX330 based plasmid for expression of Cas9 and the TTTCTAAAGGCTGAATGAAA sgRNA to target the ATM locus.DepositorInsertTTTCTAAAGGCTGAATGAAA
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #1
Plasmid#207105PurposepX330 based plasmid for expression of Cas9 and the CGCTATCAAGATTTATACCT sgRNA to target the SHLD3 locus..DepositorInsertCGCTATCAAGATTTATACCT
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATG13 sgRNA
Plasmid#207558PurposepX330 expressing Cas9 and a sgRNA targeting the ATG13 locusDepositorInsertggaaactgatctcaattccc
ExpressionMammalianPromoterCMV and U6Available SinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD2 N-terminal sgRNA
Plasmid#207098PurposepX330 based plasmid for expression of Cas9 and the TTTTTATCAGAAATCATGAG sgRNA to target the SHLD2 locus.DepositorInsertTTTTTATCAGAAATCATGAG
ExpressionMammalianPromoterCMV and U6Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
HaloTag KO sgRNA
Plasmid#207102PurposepX330 based plasmid for expression of Cas9 and the GTCGATGTTGGTCCGCGCGA sgRNA to target the HaloTag coding sequence.DepositorInsertGTCGATGTTGGTCCGCGCGA
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
MDC1 N-terminal sgRNA
Plasmid#207090PurposepX330 based plasmid for expression of Cas9 and the GTATCCTTCCCAGATCATGG sgRNA to target the MDC1 locus.DepositorInsertGTATCCTTCCCAGATCATGG
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #2
Plasmid#207106PurposepX330 based plasmid for expression of Cas9 and the CTGAAGGAACAGACTAATTC sgRNA to target the SHLD3 locus..DepositorInsertCTGAAGGAACAGACTAATTC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
ER50-SpCas9-ER50
Plasmid#85448PurposeExpresses SpCas9 fused to ER50 domain on both N- and C-termini in mammalian cellsDepositorInsertER50-SpCas9-ER50
UseAAVTagsdestabilized domain of estrogen receptor ligand b…ExpressionMammalianPromoterCbhAvailable SinceFeb. 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Puro-mStayGold-LMNB1
Plasmid#227329PurposeDonor template for Puro-2A-mStayGold insertion into the N-terminus of the LMNB1 locus. For nuclear envelope visualization. To be co-transfected with sgRNA plasmid px330-PITCh-LMNB1 (Addgene #207770)DepositorInsertLMNB1 Homology Arms flanking a Puro-2A-mStayGold (LMNB1 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-mNeon-Puro-TOMM20
Plasmid#207790PurposeDonor template for mNeon-2A-Puro insertion into the C-terminus of the TOMM20 locus. For mitochondria visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TOMM20 (Addgene #207789)DepositorInsertTOMM20 Homology Arms flanking a mNeon-Puro Cassette (TOMM20 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-moxGFP-Puro-H2BC11
Plasmid#207758PurposeDonor template for moxGFP-2A-Puro insertion into the C-terminus of the H2BC11 locus for nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H2BC11 Addgene #207755DepositorInsertH2BC11 Homology Arms flanking a moxGFP-Puro Cassette (H2BC11 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 17, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
FUG-T2A-Cas9
Plasmid#75346PurposeUbiquitin promoter expresses GFP and humanized spCas9 (from PX330) via a T2A motif. For cell transfection or use in lentiviral packaging. Use Pac1 and/or BstB1 sites to insert sgRNAs from PXL.DepositorInsertCas9
UseCRISPR and LentiviralTagsGFP (via t2a)ExpressionMammalianPromoterUbiquitinAvailable SinceMay 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-TJP1
Plasmid#227300PurposeDonor template for mStayGold insertion into the N-terminus of the TJP1 locus. For tight junction visualization. To be co-transfected with sgRNA plasmid px330-TJP1 (Addgene #227299)DepositorInsertTJP1 Homology Arms flanking a mStayGold Tag (TJP1 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mStayGold-RAB7A
Plasmid#227298PurposeDonor template for mStayGold insertion into the N-terminus of the RAB7A locus. For endosome visualization. To be co-transfected with sgRNA plasmid px330-RAB7A (Addgene #227297)DepositorInsertRAB7A Homology Arms flanking a mStayGold Tag (RAB7A Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only