We narrowed to 15,985 results for: grna
-
Plasmid#80936PurposeExpresses Cas9N in mammalian cells; expresses gRNA M3 for Mstn cleavage.DepositorInsertCas9N
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianAvailable SinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCfB2311 (SNR52p-gRNA.ADE2-SUP4t_natMX)
Plasmid#83947PurposegRNA cassette-carrying vector with natMX markerDepositorInsertgRNA targeting ADE2 gene
ExpressionYeastAvailable SinceOct. 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(LIN28A_5-4)-PGKpuroBFP-W
Plasmid#211969PurposeExpress gRNA against LIN28A with puro and BFPDepositorInsertsgRNA targeting LIN28A (LIN28A Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(LIN28A_5-3)-PGKpuroBFP-W
Plasmid#211968PurposeExpress gRNA against LIN28A with puro and BFPDepositorInsertsgRNA targeting LIN28A (LIN28A Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBbdCas9S(RBSmut)_Psyn-sgRNA500
Plasmid#149576Purposeparental, all-in-one CRISPRi vector for B. burgdorferi, parental for gRNA cloningDepositorTypeEmpty backboneUseCRISPRExpressionBacterialPromoterPflaB, PpQE30, PsynAvailable SinceNov. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHKMC1: Empty sgRNA for Cloning
Plasmid#67720PurposeEmpty vector for cloning sgRNA. NotI and BamHI for cloning sgRNA. PU6 driven sgRNA.DepositorTypeEmpty backboneExpressionWormPromoterPU6Available SinceJuly 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSB700 lenti gRNA EYFP
Plasmid#167906PurposeLentiviral vector for expressing U6 sgRNA cloning plasmidDepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable SinceFeb. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-evoCjCas9-ABE8e_gRNA
Plasmid#202561PurposehSyn-evoCjCas9-ABE8e and hU6-BsmBI-gRNA in AAV2 backbone (ITRs)DepositorInsertevoCjCas9-ABE8e
UseAAVAvailable SinceSept. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(gBFP)-PGKGFP2ABFP-W
Plasmid#67984PurposeCas9 activity reporter with GFP and BFPDepositorInsertsU6gRNA cassette, PGKGFP2ABFP cassette, WPRE
Guide RNA targeting modified BFP
UseCRISPR and LentiviralMutationDeleted BbsI site within WPRE, modified BFPAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Stk11)-PGKpuroBFP-W
Plasmid#105043PurposeLentiviral gRNA plasmid targeting mouse Stk11 , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR v2 puro hGSDME gRNA1
Plasmid#223519Purposeknocking out hGSDME in human cellsDepositorAvailable SinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
DNA-PKcs N-terminal sgRNA
Plasmid#207093PurposepX330 based plasmid for expression of Cas9 and the AGCGGGACTCGGCGGCATGG sgRNA to target the DNA-PKcs locus.DepositorInsertAGCGGGACTCGGCGGCATGG
ExpressionMammalianPromoterCMV and U6Available SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUbi_dCas9-BFP-KRAB-gRNA
Plasmid#221503PurposeCRISPRi machinery fish codon optimized expressing plasmidDepositorInsertdCas9-tagBFP-KRAB
UseFish expressionMutationD10A and H839A point mutationsPromoterZebrafish Ubiquitin promoterAvailable SinceJuly 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV(W-)U6sgRNA5(BbsI)-PGKpuroBFP
Plasmid#102797PurposeRetrovirus for testing CRISPR KO activity (empty) - non-targeting control plasmid contains GFP instead of PuroRDepositorInsertssgRNA
EGFP
UseCRISPR and RetroviralExpressionMammalianMutationH231LAvailable SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pZ148-BhCas12b-sgRNA-scaffold
Plasmid#122448PurposeExpresses sgRNA for BhCas12b in mammalian cellsDepositorInsertU6-BhCas12b-sgRNA-scaffold, CMV-mCherry
ExpressionMammalianAvailable SinceFeb. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTR-PpU6P-sgRNA-L3L2
Plasmid#113740PurposeGateway entry vector containing attL3 and attL2 sites, U6 promoter, BsaI sites for protospacer ligation, and sgRNA.DepositorInsertPpU6P::sgRNA
UseCRISPR; Gateway entry vectorPromoterP. patens U6 promoterAvailable SinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTR-PpU6P-sgRNA-L1L4
Plasmid#113736PurposeGateway entry vector containing attL1 and attL4 sites, U6 promoter, BsaI sites for protospacer ligation, and sgRNA.DepositorInsertPpU6P::sgRNA
UseCRISPR; Gateway entry vectorPromoterP. patens U6 promoterAvailable SinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA3(BbsI)-PGKpuro2ABFP
Plasmid#67990PurposeCRISPR gRNA expression vector with the conventional scaffold and puro/BFP markers without WPREDepositorInsertU6gRNA cassette with the conventional scaffold, PGKpuro2ABFP cassette
UseCRISPR and LentiviralAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SMVP-Cas9N-U6-gRNA P1
Plasmid#80943PurposeExpresses Cas9N in mammalian cells; expresses gRNA P1 for Pd-l1 binding.DepositorInsertCas9N
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianAvailable SinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-gRNA-TnT-Cre
Plasmid#132551PurposeFor loss-of-function experiments in cardiomyocytesDepositorInsertsTnT-Cre
U6-gRNA
UseAAVPromoterTnT and U6Available SinceOct. 4, 2019AvailabilityAcademic Institutions and Nonprofits only