We narrowed to 13,110 results for: LIC
-
Plasmid#106906PurposeExpresses murine phospho-mimetic CEP215 at S608DepositorInsertCEP215 (Cdk5rap2 Mouse)
TagsFLAGExpressionMammalianMutationchanged Serine-608 to Glutamic AcidPromoterCMVAvailable SinceFeb. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPICZ:hTRAAK(G124I)
Plasmid#130672PurposeP. pastoris expression vector. It will generate the human TRAAK channel (1-300) fused to a C-terminal GFPDepositorInsertKCNK4 (KCNK4 Human)
TagsSNS- 3C_cleavage_site-TAAA-GFPExpressionYeastMutationN104Q, N108Q, G124IAvailable SinceMay 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pOPTXGARE
Plasmid#68542Purposecyclic nucleotide reporter for bacteria or plant cellsDepositorInsertOPTX promoter with GARE (AT1G33440 Mustard Weed)
TagsluciferaseExpressionBacterial and PlantMutation5x GARE inserted 190 bp 5' pf ATG (GARE = ta…PromoterOPTX promoter with GAREAvailable SinceAug. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pP[RS3]3'M
Plasmid#53552Purposefor an easy screen of TALEN- and CRISPR/Cas9- mediated mutagenesis in DrosophilaDepositorInsertAscI and MluI restriction enzyme sites
ExpressionInsectPromotersame pP[RS3]Available SinceDec. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.(cyto).cpSFGFP.HaloTag
Plasmid#244109PurposeCytosolic expression of non-responsive circularly permuted Super Folder GFPDepositorInsertcpSFGFP
UseAAVTagsHaloTagAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.GFAP.(cyto).iGlucoSnFR2
Plasmid#244111PurposeCytosolic expression of green glucose sensorDepositorInsertiGlucoSnFR2
UseAAVAvailable SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAGFLEX.(cyto).iGlucoSnFR2
Plasmid#244078PurposeCytosolic expression of green glucose sensor with non-responsive HaloTagDepositorInsertiGlucoSnFR2
UseAAVAvailable SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT2BR
Plasmid#221827PurposePlasmid to express gRNA1 (ttcagtttgcccggtttaac) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-d5-HT2BR
Plasmid#221828PurposePlasmid to express gRNA2 (aggcactcgtgctcgaatag) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-for-dSERT
Plasmid#221830PurposePlasmid to express gRNA1 (cgaaatctgcgctctacttg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only