We narrowed to 10,515 results for: nar;
-
Plasmid#58913Purposemammalian expression of human Rb with all Ser/Thr Cdk acceptor sites removed and S608 restoredDepositorInsertRb (RB1 Human)
UseTagsHAExpressionMammalianMutationdelta CDK* with S608 restoredPromoterCMVAvailable sinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
PH Akt-Venus
Plasmid#85223PurposeVenus tagged PH domain of Akt for use as a PIP3 sensorDepositorInsertPH AKT(1-148) (AKT1 Human)
UseTagsVenusExpressionMammalianMutationPromoterCMVAvailable sinceJan. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
pJM671 EF1α TC 3xFLAG-FRB-FGFR4-PRS(M)-(GS)-NLS-VP64-ZF6 in TUPV3
Plasmid#161573PurposeConstitutive expression of TC 3xFLAG-FRB-FGFR4-PRS(M)-(GS)-NLS-VP64-ZF6 under the EF1α promoterDepositorInsertTC 3xFLAG-FRB-FGFR4-PRS(M)-(GS)-NLS-VP64-ZF6
UseSynthetic BiologyTags3x-FLAGExpressionMammalianMutationPromoterEF1αAvailable sinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
mTiam1-mcherry-sspB in pcDNA3.1
Plasmid#85221PurposeRole of Rac selective GEF domain from Tiam1 in immune cell migrationDepositorInsertsUseTagsnoneExpressionMammalianMutationPromoterCMVAvailable sinceJan. 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-iCAP-PHP.B3
Plasmid#103004Purposenon-standard AAV2 rep-AAV-PHP.B3 cap plasmid with AAV cap expression controlled by a tTA-TRE amplification systemDepositorInsertSynthetic construct isolate AAV-PHP.B3 VP1 gene
UseAAVTagsExpressionMammalianMutationPromoterp41Available sinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-iCAP-PHP.B2
Plasmid#103003Purposenon-standard AAV2 rep-AAV-PHP.B2 cap plasmid with AAV cap expression controlled by a tTA-TRE amplification systemDepositorInsertSynthetic construct isolate AAV-PHP.B2 VP1 gene
UseAAVTagsExpressionMammalianMutationPromoterp41Available sinceDec. 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-(STChRger2-TS-EYFP)
Plasmid#129394PurposeSoma Targeted, High photocurrent, low-light sensitive channelrhodopsin (ChRger2) for optogenetic activation with systemic delivery or for low-light activation. Uses the CAG promoter and double floxed.DepositorInsertsoma targeted ChRger2
UseAAV and Cre/LoxTagsKv2.1-TS-EYFPExpressionMammalianMutationPromoterCAGAvailable sinceOct. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
pcDNA3-EphB4-Fc
Plasmid#200986PurposeMammalian expression plasmid for soluble EphB4 fused to IgG1 FcDepositorInsertEphB4 (EPHB4 Human)
UseTagsFc region of human IgG1ExpressionMammalianMutationSoluble ectodomain of EphB4PromoterCMVAvailable sinceOct. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
CAG-GCaMP6f-3x-miR204-5p-3x-miR122-TS
Plasmid#117384PurposeAn AAV genome containing miRNA target sequences (TS) 204-5p and 122 to reduce expression of GCaMP6f in astrocytes and hepatocytes, respectivelyDepositorInsertGCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA
UseAAVTagsExpressionMammalianMutationPromoterCAGAvailable sinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRP(Exp)-CMV> ORF_924bp (Azgp1):T2A:dTomato:IRES:Puro
Plasmid#110830PurposeExpresses zinc alpha-2 glycoprotein (ZAG) and dTomato (dT) reporter where both sequences are separated by a T2A self-cleaving peptide sequence as a result, the dT is not fused with the ZAG protein.DepositorInsertAZGP1 (Azgp1 Mouse)
UseNon-viral gene expression vectorTagsT2A and dTomatoExpressionMutationPromoterCMVAvailable sinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-STChRger2-TS-EYFP
Plasmid#129395PurposeSoma Targeted, High photocurrent, low-light sensitive channelrhodopsin (ChRger2) for optogenetic activation with systemic delivery or for low-light activation. Driven by human Synapsin I promoter.DepositorInsertsoma targeted ChRger2
UseAAVTagsKv2.1-TS-EYFPExpressionMammalianMutationPromoterhSynAvailable sinceOct. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
pCMV HA hRB delta CDK + S780
Plasmid#58915Purposemammalian expression of human Rb with all Ser/Thr Cdk acceptor sites removed and S780 restoredDepositorInsertRb (RB1 Human)
UseTagsHAExpressionMammalianMutationdelta CDK* with S780 restoredPromoterCMVAvailable sinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
-
pJM612 EF1α TC 3xFLAG-FRB-FGFR4-PRS(M)-(GS)-NLS-VP64-ZF1 in TUPV3
Plasmid#161571PurposeConstitutive expression of TC 3xFLAG-FRB-FGFR4-PRS(M)-(GS)-NLS-VP64-ZF1 under the EF1α promoterDepositorInsertTC 3xFLAG-FRB-FGFR4-PRS(M)-(GS)-NLS-VP64-ZF1
UseSynthetic BiologyTags3x-FLAGExpressionMammalianMutationPromoterEF1αAvailable sinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-PM-InPAkt
Plasmid#181915PurposeIndicator of Phosphoinositides using Akt; targeted to the plasma membrane.DepositorInsertpm-InPAkt
UseTags6xHIS - T7 tag (gene 10 leader) - Xpress (TM) tag…ExpressionMammalianMutationContains the following mutations with respect to …PromoterCMVAvailable sinceJuly 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBW_0001
Plasmid#102833PurposeBinary vector containing Sr22 Schomburgk allele driven by maize ubiquitin promoter, Sr22 terminatorDepositorInsertSr22 Schomburgk (NEWENTRY Synthetic)
UseTagsExpressionPlantMutationPromoterMaize ubiquitinAvailable sinceFeb. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV HA hRB delta CDK + S811
Plasmid#58919Purposemammalian expression of human Rb with all Ser/Thr Cdk acceptor sites removed and S811 restoredDepositorInsertRb (RB1 Human)
UseTagsHAExpressionMammalianMutationdelta CDK* with S811 restoredPromoterCMVAvailable sinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only