We narrowed to 13,867 results for: cas9
-
Plasmid#72364PurposeEncodes gRNA for 3' target of human ZNF3 along with Cas9 with 2A GFPDepositorAvailable SinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pML104-KanMx4
Plasmid#83476PurposeExpresses Cas9 and contains guide RNA expression cassette with BclI-SwaI cloning sites for guide sequence cloning; Contains KanMx4 marker for yeast transformation.DepositorInsertKanMX4
UseTagsExpressionYeastMutationPromoterAvailable SinceOct. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV-ABE8eWQ
Plasmid#161815PurposeExpresses ABE8eWQ in mammalian cellsDepositorInsertbpNLS-TadA8e(V106W/D108Q)-32AA linker-hSpCas9(D10A)-bpNLS-P2A-EGFP-NLS
UseCRISPRTagsExpressionMammalianMutationD10A in S. pyogenes Cas9, TadA mutations describe…PromoterAvailable SinceJan. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4
Plasmid#83475PurposeExpresses Cas9 and contains guide RNA expression cassette with BclI-SwaI cloning sites for guide sequence cloning; Contains HphMx4 marker for yeast transformation.DepositorInsertHphMX4
UseTagsExpressionYeastMutationPromoterAvailable SinceOct. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET-MBP-NLS-Geo_st
Plasmid#87703PurposeExpression plasmid for Cas9 from Geobacillus stearothermophilus with an N-Term MBP and SV40 NLSDepositorInsertGeoCas9
UseTags10xHis-MBP-TEVExpressionBacterialMutationPromoterAvailable SinceJune 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pML104-NatMx3
Plasmid#83477PurposeExpresses Cas9 and contains guide RNA expression cassette with BclI-SwaI cloning sites for guide sequence cloning; Contains NatMX3 marker for yeast transformation.DepositorInsertNatMx3
UseTagsExpressionYeastMutationPromoterAvailable SinceOct. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSBtet-RB-PE2
Plasmid#173903PurposeSB-transposon with inducible expression of SpCas9 PE2DepositorInsertPE2
UseCRISPRTagsSV40 NLSExpressionMammalianMutationPromoterAvailable SinceOct. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRDA_837
Plasmid#245328PurposeCas9 CRISPRko positive control guide; targets CD55DepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-KAE1
Plasmid#232891PurposePlasmid expressing Cas9 and gRNA GATGACAACTGAATGCAGAG which targets the KAE1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SAM50
Plasmid#232895PurposePlasmid expressing Cas9 and gRNA AATAGTTTATGTAAGAACAG which targets the SAM50 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ARB1
Plasmid#232888PurposePlasmid expressing Cas9 and gRNA CAAAAACTAACTGCTTACGG which targets the ARB1 gene.DepositorAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-RER2
Plasmid#232884PurposePlasmid expressing Cas9 and gRNA AGAATCGCATCTCTACACGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-3
Plasmid#232894PurposePlasmid expressing Cas9 and gRNA GTTCTTAACTAGGATCATGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-3
Plasmid#232886PurposePlasmid expressing Cas9 and gRNA GAAGTAACAAAGGAACCTAG which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-2
Plasmid#232885PurposePlasmid expressing Cas9 and gRNA TCGTACCACCAAGGAATTAC which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-AVO1
Plasmid#232889PurposePlasmid expressing Cas9 and gRNA AATGATGACGACCATACCAG which targets the AVO1 gene.DepositorAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-YFR054C
Plasmid#232900PurposePlasmid expressing Cas9 and gRNA GCTCAAAGAAACAATTAGAG which targets the YFR054C gene.DepositorInsertYFR054C gRNA (YFR054C Budding Yeast)
UseCRISPRTagsExpressionYeastMutationPromotersnR52Available SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ZIM17
Plasmid#232901PurposePlasmid expressing Cas9 and gRNA AAATGTCTCACTTTGCAGTG which targets the ZIM17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SRP14
Plasmid#232896PurposePlasmid expressing Cas9 and gRNA GAAAACAAAATGCTCAACAG which targets the SRP14 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-TLG1
Plasmid#232897PurposePlasmid expressing Cas9 and gRNA GATGAAAACGAAGACGTGAG which targets the TLG1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VHT1
Plasmid#232898PurposePlasmid expressing Cas9 and gRNA TGCGGCCACACTGAAATACG which targets the VHT1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ADE13
Plasmid#232887PurposePlasmid expressing Cas9 and gRNA GTAGCAGCAAAAGAAGACAA which targets the ADE13 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-LAS17
Plasmid#232892PurposePlasmid expressing Cas9 and gRNA AATACCCTGAATTCTGCCGG which targets the LAS17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#232883PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-INO80
Plasmid#232890PurposePlasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCG-scr
Plasmid#229847PurposeExpresses wild-type Cas9 and scrambled gRNA.DepositorInsertguide RNA with scrambled sequence
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable SinceJan. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSBbi-RB-PE2
Plasmid#173902PurposeSB-transposon with constitutive expression of SpCas9 PE2DepositorInsertPE2
UseCRISPRTagsSV40 NLSExpressionMammalianMutationPromoterAvailable SinceOct. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
HCP1
Plasmid#166103PurposeThis plasmid encodes a Cas9 protein as well as a sgRNA that targets Msn2, which will create a double strand break and allow C-terminus tagging via homologous recombination.DepositorAvailable SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAMTA2.1.0-gDNA
Plasmid#132456PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorAvailable SinceJuly 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMBD1.1.0-gDNA
Plasmid#132444PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorAvailable SinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX335 Mouse 5' Srcap gRNA A
Plasmid#127904PurposeCas9 D10A Nickase Vector targeting the 5' end of the mouse Srcap geneDepositorInsertSrcap gRNA
UseCRISPRTagsExpressionMutationPromoterAvailable SinceSept. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX330 Mouse 3' Ubf gRNA
Plasmid#127902PurposeWT Cas9 Vector targeting the 3' end of the mouse Ubf geneDepositorInsertgRNA for Mouse 3' Ubf
UseCRISPRTagsExpressionMutationPromoterAvailable SinceSept. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
AICSDP-8:TOMM20-mEGFP
Plasmid#87423PurposeHomology arms and linker-mEGFP sequence for C-terminus tagging of human TOMM20DepositorInsertTOMM20 Homology Arms with linker-mEGFP (TOMM20 Human)
UseCRISPR; Donor templateTagslinker-mEGFPExpressionMammalianMutationhomology arms contain point mutations to disrupt …PromoterAvailable SinceMarch 15, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
AICSDP-9:DSP-mEGFP
Plasmid#87424PurposeHomology arms and linker-mEGFP sequence for C-terminus tagging of human DSPDepositorInsertDSP Homology Arms with linker-mEGFP (DSP Human)
UseCRISPR; Donor templateTagslinker-mEGFPExpressionMammalianMutationhomology arms contain point mutations to disrupt …PromoterAvailable SinceMarch 15, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
AICSDP-7:SEC61B-mEGFP
Plasmid#87426PurposeHomology arms and linker-mEGFP sequence for N-terminus tagging of human SEC61BDepositorInsertSEC61B Homology Arms with mEGFP-linker (SEC61B Human)
UseCRISPR; Donor templateTagsmEGFP-linkerExpressionMammalianMutationhomology arms contain point mutations to disrupt …PromoterAvailable SinceMarch 15, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
pVSV-G
Plasmid#138479PurposeExpresses VSV-G envelope protein for pseudotyping NanoMEDIC particle.DepositorInsertVSV-G envelop protein
UseTagsExpressionMammalianMutationPromoterAvailable SinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
Pdpy-30-miniCAFE
Plasmid#170115PurposeDpy-30 promoter-driven expression of a truncated VPR-dCjCas9 fusion protein (MiniCAFE) for activation of gene expression.DepositorInsertMiniCAFE
UseCRISPRTagsExpressionMutationD8A, HNH-truncation (Δ495–609 aa) in CjCas9PromoterDpy-30Available SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
AICSDP-10:LMNB1-mEGFP
Plasmid#87422PurposeHomology arms and linker-mEGFP sequence for N-terminus tagging of human LMNB1DepositorInsertLMNB1 Homology Arms with mEGFP-linker (LMNB1 Human)
UseCRISPR; Donor templateTagsmEGFP-linkerExpressionMammalianMutationhomology arms contain point mutations to disrupt …PromoterAvailable SinceMarch 15, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-i53
Plasmid#92170Purposerecombinant adeno-associated viral plasmid for delivery and expression of ubiquitin variant (i53) that is a selective inhibitor of 53BP1DepositorInserti53
UseAAVTagsFLAGExpressionMammalianMutationUbvG08 with I44A mutation and no terminal GlycinesPromoterCMVAvailable SinceJuly 13, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
pORANGE GFP-Grin1 KI
Plasmid#131485PurposeEndogenous tagging of GluN1: N-terminal (amino acid position: A20)DepositorUseTagsExpressionMammalianMutationPromoterU6 and CbhAvailable SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only