We narrowed to 19,882 results for: Nov
-
Plasmid#29420DepositorInsertAmber-Cerulean-Amber-Venus
UseStoichiometry standardExpressionMammalianAvailable sinceJune 23, 2011AvailabilityAcademic Institutions and Nonprofits only -
HOXB6-pSVL
Plasmid#20995DepositorInsertHOXB6 (HOXB6 Human)
ExpressionMammalianAvailable sinceAug. 14, 2009AvailabilityAcademic Institutions and Nonprofits only -
HI.HslUV.RSET.FL.wt
Plasmid#12538DepositorPublicationInsertHaemophilus influenzae heat shock loci U and V
ExpressionBacterialMutationnoneAvailable sinceOct. 16, 2006AvailabilityAcademic Institutions and Nonprofits only -
pv6_MCPH1_BRCT W706RW815R
Plasmid#250355PurposeExpresses mutant tandem BRCT domain from MCPH1 fused to eGFP. Serves as control.DepositorInsertMCPH1 tandem BRCT
TagsNLS, eGFP and biotintag, TEV cleavageExpressionMammalianMutationW706R and W815RPromoterCAGGSAvailable sinceFeb. 10, 2026AvailabilityAcademic Institutions and Nonprofits only -
AAV-GfaABC1D-iCreV-4x6T
Plasmid#196412PurposeAstrocytic expression of light-inducible iCreV recombinase in AAV; astrocyte specificity enhanced with 4x6T miRNA targeting cassetteDepositorInsertiCreV
UseAAV; Astrocyte-selectiveExpressionMammalianPromoterCAG and GfaABC1DAvailable sinceFeb. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG668 lifeAct-pFAST
Plasmid#172866PurposeExpresses LifeAct-pFAST in mammalian cells (actin labeling)DepositorInsertLifeAct-pFAST
TagsMyc tag (C terminal on insert)ExpressionMammalianPromoterCMVAvailable sinceFeb. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAG876 pDisplay-pFAST
Plasmid#172868Purposeexpresses pFAST at the surface of mammalian cellsDepositorInsertpFAST-PDGFR
TagsIgK leader sequence (N terminal on insert) and My…ExpressionMammalianPromoterCMVAvailable sinceFeb. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-YdLight1
Plasmid#125705PurposeExpresses the yellow genetically encoded dopamine sensor YdLight1 in mammalian cells.DepositorInsertYdLight1
TagsFlag tagExpressionMammalianPromoterCMVAvailable sinceJuly 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTet-GLI2shR
Plasmid#136691PurposeInducible Gli2 shRNA lentiviral plasmid (target sequence: human GLI2 5′CCGGCCTGGCATGACTACCACTATGCTCGAGCATAGTGGTAGTCATGCCAGGTTTTTG 3′)DepositorInsertshRNA_humanGli2 (GLI2 Human)
UseLentiviralAvailable sinceJune 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV- CAG-h2BmRuby2FLAG
Plasmid#116872PurposeNuclear localized mRuby2FLAGDepositorInsertH2BmRuby2FLAG
UseAAVAvailable sinceNov. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGEMT-Pax7bait-P2a-GAP43-Cherry-T2a-mERt-Cre-Ert
Plasmid#111153Purposeknock in bait for Axolotl Pax7 locusDepositorInsertGAP43-Cherry-T2a-mERt-Cre-Ert
UseCre/LoxMutationwtAvailable sinceJune 18, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pGL4.23 A82V 2014 EBOV + Mucin-Like Domain
Plasmid#86016PurposeEbola Virus (Makona) Glycoprotein in CMV driven mammalian expression vectorDepositorInsertMakona Ebola Virus Glycoprotein
ExpressionMammalianMutationChanged alanine 82 to valinePromoterCMV IEAvailable sinceJan. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pXPR_219
Plasmid#164559PurposeLentiviral vector that encodes two sgRNA expression cassettes. Also encodes the fluorophore violet-excited GFP (Vex) as a marker of transduction.DepositorInsertsFirst sgRNA cassette
Second sgRNA cassette
UseCRISPR and Lentiviral; Dual sgrnaExpressionMammalianPromoterHuman U6 and Mouse U6Available sinceNov. 28, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
SpCas9 TadCBEa
Plasmid#193782PurposeExpress TadCBEa (with SpCas9) in mammalian cellsDepositorInsertTadA-CDa-SpCas9D10A
ExpressionMammalianAvailable sinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2 puro - CRBN (#2)
Plasmid#166241PurposesgRNA (#2) to generate a knockout of human CRBN by targeting the start region of Exon1DepositorAvailable sinceDec. 20, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pRRL-MND-hCard11 WT-T2A-GFP
Plasmid#163787PurposeExpression of Wild-type CARD11DepositorAvailable sinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
p-mCherry-C1-iC++_CA
Plasmid#98168Purposeslow cycling (open for minutes) step-function artificial anion conducting channelrhodopsin (aACR). High light sensitivity. Activation with cyan light, inactivation max with 590 nm (accelarates closure to ms). Codon optimized for mammalian expression.DepositorInsertSynthetic construct iC++_C128A gene
TagsmCherryExpressionMammalianMutationT59S, E83N, E90Q, E101S, V117R, E123S, C128A, V24…PromoterCMV (+enhancer)Available sinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
LIR-wtloxP-TRE-CAG-Frt-red-puro-3xPA-Frt-GFP(mVenus)-KrasG12D-cMyc-SV40LT-IRES-KRABoff-PA-TRE-loxP257-RIR
Plasmid#67277Purposeinducbile color change and cancer regulation: FlpO recombinase dependent expression of KrasG12D cMyc and SV40 large T antigen with doxycycline inducible downregulation through tetKRAB system.DepositorInsertsfirst casette contain a red fluorescent protein (katushka) linked to puromycin resitance gene through an E2A site
second cassette contains mVENUS-kras-cmyc-SV40LT-KRABoff
TagsmTQ2 blue fluorescent and red flourescent gene ka…ExpressionMammalianPromoterCAGAvailable sinceAug. 7, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMS26
Plasmid#32295DepositorTypeEmpty backboneUseBacterial gene additionExpressionBacterialPromoterrhaBAvailable sinceSept. 26, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
PE-SUMO CRYAB
Plasmid#217670PurposeFor expression of SUMO tagged human alpha B crystallinDepositorAvailable sinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only