We narrowed to 66,047 results for: %s

#178165

Donor vector for endogenous tagging of human PARK7 at the C-terminus with halotag

iPSC Neurodegenerative Disease Initiative (iNDI), Michael Ward

Dec. 2, 2021

Academic Institutions and Nonprofits only

#167554

S. flexneri O antigen genes cloned from pPM2213 into pJRD215

Renato Morona

Morona et al J Bacteriol. 1994 Feb;176(3):733-47. doi

May 18, 2021

Academic Institutions and Nonprofits only

#87409

p426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87391

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87392

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS720a sequence CAACAATTGTTACAATAGTA in yeast chromosome 7.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87395

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1021b sequence CCTCTGTGTGGTGGTAATTG in yeast chromosome 10.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87397

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1114a sequence CTTGTGAAACAAATAATTGG in yeast chromosome 11.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87400

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1414a sequence GCGCCACAGTTTCAAGGGTC in yeast chromosome 14.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#65805

NMD reporter mRNA

Niels Gehring

Boehm et al Cell Rep. 2014 Oct 23;9(2):555-68. doi:

Sept. 17, 2015

Academic Institutions and Nonprofits only

#50722

expression of the human TPI Lys13Arg allele in yeast

Markus Ralser

Gruning et al Open Biol. 2014 Mar 5;4(3):130232. doi:

Feb. 20, 2014

Academic Institutions and Nonprofits only

#50721

expression of the human TPI Ile170Thr allele in yeast

Markus Ralser

Gruning et al Open Biol. 2014 Mar 5;4(3):130232. doi:

Feb. 20, 2014

Academic Institutions and Nonprofits only

#50720

expression of the human TPI Ile170Val allele in yeast

Markus Ralser

Gruning et al Open Biol. 2014 Mar 5;4(3):130232. doi:

Feb. 20, 2014

Academic Institutions and Nonprofits only

#50726

overexpression of the human TPI1 Lys13Arg allele in E.coli

Markus Ralser

Gruning et al Open Biol. 2014 Mar 5;4(3):130232. doi:

Feb. 1, 2014

Academic Institutions and Nonprofits only

#50724

overexpression of the human TPI1 Ile170Val allele in E.coli

Markus Ralser

Gruning et al Open Biol. 2014 Mar 5;4(3):130232. doi:

Jan. 31, 2014

Academic Institutions and Nonprofits only

#213899

Imaging of KIF5B fused to HaloTag

Lukas Kapitein

March 20, 2024

Academic Institutions and Nonprofits only

#55860

Localization: Endoplasmic Reticulum, Excitation: 558, Emission: 605

Michael Davidson

March 12, 2015

Industry, Academic Institutions, and Nonprofits